Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001407.1

Orthogroup ID

OG0001938

Physical Location & Seq

Genomic Coordinates Forward (+)

41069 .. 42591

Gene Structure 1523 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001407.1_g000010.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 561 bp

atggaggtgtttaggacaaaagttgacgaggcggaacagtgtaaagctcaactgcagcaagcaattgctaattgtgaaccagagtttgtagacatatgtgctgtcatgggtgagaaaccaccacataggaaccgtttgaagctgataatggaccacatgagcatgctaaactccctgtgcttggttcttggtatggattttaaacacacaattcatgaaatccaccccaccttagatgatcttaatggagaaaaagatgtagcgaacagcacaatcgagggtttggctaattcggttcaaatattgagagaggtcaagatacagagatggcagaagcttcaaactttcgcaagtgccctcttagagatgtggaatctgatggatacaaccatggaggagcaaaagaaatatcagaatgtaactagtcgcatagttgcttcagaatctgaaatcactgagcctaacattctttctgtagaccttctaaatgatgttgaagttgaagtgtcaaagttggagcagcgcaagtcaattaagctcaaagagatccttctgaaatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

MAP65_ASE1

Protein Analysis

186

Amino Acids

21.36

Weight (kDa)

5.2

Isoelectric Point (pI)

37.11

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001938)

Species	Orthologous Gene IDs
malus_domestica	MD02G1203200.v1.1
prunus_persica	Prupe.2G146300_v2.0.a1 Prupe.2G146300_v2.0.a1
pyrus_communis	pycom02g16610
rosa_chinensis	RchiOBHm_Chr1g0350681 RchiOBHm_Chr4g0407401 RchiOBHm_Chr5g0031831 RchiOBHm_Chr5g0072841 RchiOBHm_Chr7g0189031 RchiOBHm_Chr7g0208631
rosa_laevigata	RLG00000028306 RLG00000028307 RLG00000028464
rosa_multiflora	Rmu_sc0001407.1_g000010 Rmu_sc0003160.1_g000008 Rmu_sc0005069.1_g000020 Rmu_sc0009633.1_g000001
rosa_roxburghii	Rroxscaffold_4G00304620 Rroxscaffold_4G00320860 Rroxscaffold_5G00337990
rosa_rugosa	Rorug01G0181900 Rorug01G0182000 Rorug01G0213000
rosa_samantha	Rh1AG227200 Rh1BG196700 Rh1CG212200 Rh1DG224700 Rh2AG170800 Rh2DG176800 Rh4AG144000 Rh4BG240200 Rh4CG150500 Rh4CG150600 Rh4DG138200 Rh4DG149100 Rh4DG149200 Rh5BG497300 Rh5CG245600 Rh5CG521200 Rh5DG227200 Rh6CG175000 Rh7BG451500
rosa_wichuraiana	Rw0G015830 Rw1G019680 Rw5G044300 Rw6G014400

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	2 cut(s)	90, 477
AciI	CCGC	1 cut(s)	32
AclWI	GGATC	1 cut(s)	541
AcuI	CTGAAG	1 cut(s)	423
AfiI	CCNNNNNNNGG	1 cut(s)	181
AgsI	TTSAA	5 cut(s)	139, 299, 341, 497, 503
AhlI	ACTAGT	1 cut(s)	422
AluBI	AGCT	4 cut(s)	47, 142, 337, 538
AluI	AGCT	4 cut(s)	47, 142, 337, 538
AlwI	GGATC	1 cut(s)	541
AlwNI	CAGNNNCTG	1 cut(s)	446
ApeKI	GCWGC	2 cut(s)	55, 520
AspLEI	GCGC	1 cut(s)	525
AspS9I	GGNCC	1 cut(s)	151
AsuHPI	GGTGA	1 cut(s)	122
AvaII	GGWCC	1 cut(s)	151
BaeGI	GKGCMC	1 cut(s)	358
BbvI	GCAGC	2 cut(s)	67, 532
BccI	CCATC	2 cut(s)	321, 373
BciVI	GTATCC	1 cut(s)	376
BcuI	ACTAGT	1 cut(s)	422
BfaI	CTAG	1 cut(s)	423
BfmI	CTRYAG	2 cut(s)	53, 474
BfuI	GTATCC	1 cut(s)	376
BisI	GCNGC	2 cut(s)	56, 521
BlsI	GCNGC	2 cut(s)	57, 522
Bme18I	GGWCC	1 cut(s)	151
BmgT120I	GGNCC	1 cut(s)	151
BmiI	GGNNCC	1 cut(s)	131
BsaJI	CCNNGG	1 cut(s)	390
Bsc4I	CCNNNNNNNGG	1 cut(s)	181
BseDI	CCNNGG	1 cut(s)	390
BseLI	CCNNNNNNNGG	1 cut(s)	181
BseMII	CTCAG	1 cut(s)	447
BseRI	GAGGAG	1 cut(s)	410
BseSI	GKGCMC	1 cut(s)	358
BseXI	GCAGC	2 cut(s)	67, 532
BslI	CCNNNNNNNGG	1 cut(s)	181
Bsp1286I	GDGCHC	1 cut(s)	358
Bsp143I	GATC	2 cut(s)	238, 546
Bsp19I	CCATGG	1 cut(s)	390
BspACI	CCGC	1 cut(s)	32
BspCNI	CTCAG	1 cut(s)	448
BspHI	TCATGA	1 cut(s)	214
BspLI	GGNNCC	1 cut(s)	131
BspMAI	CTGCAG	1 cut(s)	57
BspPI	GGATC	1 cut(s)	541
BssECI	CCNNGG	1 cut(s)	390
BssMI	GATC	2 cut(s)	238, 546
BssT1I	CCWWGG	1 cut(s)	390
Bst4CI	ACNGT	2 cut(s)	39, 134
BstC8I	GCNNGC	2 cut(s)	60, 164
BstDEI	CTNAG	3 cut(s)	232, 361, 456
BstDSI	CCRYGG	1 cut(s)	390
BstHHI	GCGC	1 cut(s)	525
BstKTI	GATC	2 cut(s)	241, 549
BstMBI	GATC	2 cut(s)	238, 546
BstNSI	RCATGY	1 cut(s)	166
BstSFI	CTRYAG	2 cut(s)	53, 474
BstSLI	GKGCMC	1 cut(s)	358
BstV1I	GCAGC	2 cut(s)	67, 532
BstX2I	RGATCY	1 cut(s)	546
BstYI	RGATCY	1 cut(s)	546
BsuI	GTATCC	1 cut(s)	376
BtgI	CCRYGG	1 cut(s)	390
BtsIMutI	CAGTG	2 cut(s)	44, 453
Cac8I	GCNNGC	2 cut(s)	60, 164
CaiI	CAGNNNCTG	1 cut(s)	446
CciI	TCATGA	1 cut(s)	214
CfoI	GCGC	1 cut(s)	525
Cfr13I	GGNCC	1 cut(s)	151
CviAII	CATG	5 cut(s)	106, 157, 163, 215, 391
CviJI	RGCY	6 cut(s)	47, 142, 287, 337, 460, 538
CviKI_1	RGCY	6 cut(s)	47, 142, 287, 337, 460, 538
DdeI	CTNAG	3 cut(s)	232, 361, 456
DpnI	GATC	2 cut(s)	240, 548
DpnII	GATC	2 cut(s)	238, 546
DraI	TTTAAA	1 cut(s)	202
EciI	GGCGGA	1 cut(s)	47
Eco130I	CCWWGG	1 cut(s)	390
Eco47I	GGWCC	1 cut(s)	151
Eco57I	CTGAAG	1 cut(s)	423
EcoT14I	CCWWGG	1 cut(s)	390
ErhI	CCWWGG	1 cut(s)	390
FaeI	CATG	5 cut(s)	109, 160, 166, 218, 394
FalI	AAGNNNNNCTT	1 cut(s)	534
FatI	CATG	5 cut(s)	105, 156, 162, 214, 390
FauNDI	CATATG	1 cut(s)	95
FblI	GTMKAC	2 cut(s)	90, 477
Fnu4HI	GCNGC	2 cut(s)	56, 521
Fsp4HI	GCNGC	2 cut(s)	56, 521
FspBI	CTAG	1 cut(s)	423
GlaI	GCGC	1 cut(s)	524
GluI	GCNGC	2 cut(s)	56, 521
HhaI	GCGC	1 cut(s)	525
Hin1II	CATG	5 cut(s)	109, 160, 166, 218, 394
Hin6I	GCGC	1 cut(s)	523
HinP1I	GCGC	1 cut(s)	523
HincII	GTYRAC	1 cut(s)	25
HindII	GTYRAC	1 cut(s)	25
HindIII	AAGCTT	1 cut(s)	335
HinfI	GANTC	2 cut(s)	373, 443
HphI	GGTGA	1 cut(s)	122
Hpy166II	GTNNAC	4 cut(s)	25, 77, 91, 478
Hpy188I	TCNGA	5 cut(s)	378, 414, 442, 448, 555
Hpy188III	TCNNGA	2 cut(s)	215, 316
Hpy8I	GTNNAC	4 cut(s)	25, 77, 91, 478
HpyAV	CCTTC	2 cut(s)	491, 560
HpyCH4III	ACNGT	2 cut(s)	39, 134
HpyCH4V	TGCA	1 cut(s)	55
HpyF3I	CTNAG	3 cut(s)	232, 361, 456
Hsp92II	CATG	5 cut(s)	109, 160, 166, 218, 394
HspAI	GCGC	1 cut(s)	523
Kzo9I	GATC	2 cut(s)	238, 546
LmnI	GCTCC	2 cut(s)	397, 517
LpnPI	CCDG	2 cut(s)	93, 188
Lsp1109I	GCAGC	2 cut(s)	67, 532
MaeI	CTAG	1 cut(s)	423
MaeIII	GTNAC	1 cut(s)	418
MalI	GATC	2 cut(s)	240, 548
MboI	GATC	2 cut(s)	238, 546
MfeI	CAATTG	1 cut(s)	63
MflI	RGATCY	1 cut(s)	546
MhlI	GDGCHC	1 cut(s)	358
MluCI	AATT	5 cut(s)	63, 70, 210, 289, 531
MmeI	TCCRAC	1 cut(s)	495
MnlI	CCTC	5 cut(s)	22, 271, 304, 368, 388
MseI	TTAA	3 cut(s)	201, 243, 534
MslI	CAYNNNNRTG	1 cut(s)	161
MunI	CAATTG	1 cut(s)	63
NcoI	CCATGG	1 cut(s)	390
NdeI	CATATG	1 cut(s)	95
NdeII	GATC	2 cut(s)	238, 546
NlaIII	CATG	5 cut(s)	109, 160, 166, 218, 394
NlaIV	GGNNCC	1 cut(s)	131
NspI	RCATGY	1 cut(s)	166
PaeI	GCATGC	1 cut(s)	166
PagI	TCATGA	1 cut(s)	214
PfeI	GAWTC	2 cut(s)	373, 443
PkrI	GCNGC	2 cut(s)	57, 522
PspN4I	GGNNCC	1 cut(s)	131
PspPI	GGNCC	1 cut(s)	151
PstI	CTGCAG	1 cut(s)	57
PstNI	CAGNNNCTG	1 cut(s)	446
PsuI	RGATCY	1 cut(s)	546
RseI	CAYNNNNRTG	1 cut(s)	161
SaqAI	TTAA	3 cut(s)	201, 243, 534
SatI	GCNGC	2 cut(s)	56, 521
Sau3AI	GATC	2 cut(s)	238, 546
Sau96I	GGNCC	1 cut(s)	151
SduI	GDGCHC	1 cut(s)	358
SetI	ASST	8 cut(s)	9, 49, 144, 233, 315, 339, 483, 540
SfcI	CTRYAG	2 cut(s)	53, 474
SinI	GGWCC	1 cut(s)	151
SmiMI	CAYNNNNRTG	1 cut(s)	161
SpeI	ACTAGT	1 cut(s)	422
SphI	GCATGC	1 cut(s)	166
Sse9I	AATT	5 cut(s)	63, 70, 210, 289, 531
SsiI	CCGC	1 cut(s)	32
SspI	AATATT	1 cut(s)	303
SspMI	CTAG	1 cut(s)	423
StyI	CCWWGG	1 cut(s)	390
TaaI	ACNGT	2 cut(s)	39, 134
TaqI	TCGA	1 cut(s)	276
TasI	AATT	5 cut(s)	63, 70, 210, 289, 531
TfiI	GAWTC	2 cut(s)	373, 443
Tru1I	TTAA	3 cut(s)	201, 243, 534
Tru9I	TTAA	3 cut(s)	201, 243, 534
TscAI	CASTG	2 cut(s)	44, 460
TseI	GCWGC	2 cut(s)	55, 520
TspDTI	ATGAA	2 cut(s)	203, 231
TspRI	CASTG	2 cut(s)	44, 460
VpaK11BI	GGWCC	1 cut(s)	151
XceI	RCATGY	1 cut(s)	166
XmiI	GTMKAC	2 cut(s)	90, 477
XspI	CTAG	1 cut(s)	423

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.