Rw5G044300

Microtubule associated protein (MAP65/ASE1 family)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr5
OG0001938
Physical Location & Seq
Forward (+)
77972130 .. 77973737
1608 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw5G044300.1

Sequence Viewer

Length: 363 bp
ATGGACCACATGAGCATGCTAAACTCCCTGTGCTTGGTTCTTGGTATGGATTTTAAACACACAATTCATGAAATCCACCCCACCTTAGATGATCTTAATGGAGAAAAAGACTTAGCGAACAGCACAATCGAGGGTTTGGCTGATTCGGTTCAAATATTGAGAGAGGTCAAGATACAGAGATGGCAGAGGCTTCAAACTTTCGCAAGTGCCCTCTTGGAGATGTGGAATCTGATGGGTACAACCATGGAGGAGCAAAAGAAATATAAGAATTTAACTAGTCGCATAGCTGCTTCAAAATCTGAAATCACTGAGCCTAACATTCTTTCTGTAGACCTTCTAAATGATGAATGGTGGAAACATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
MAP65_ASE1

Protein Analysis

120

Amino Acids

13.9

Weight (kDa)

5.26

Isoelectric Point (pI)

44.98

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
MAP65_ASE1 PF03999 5 - 111 1.1e-09 Microtubule associated protein (MAP65/ASE1 family)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 330
AcsI RAATTY 1 cut(s) 268
AfaI GTAC 1 cut(s) 238
AfiI CCNNNNNNNGG 1 cut(s) 34
AgsI TTSAA 3 cut(s) 152, 194, 294
AhlI ACTAGT 1 cut(s) 275
AluBI AGCT 1 cut(s) 287
AluI AGCT 1 cut(s) 287
ApeKI GCWGC 1 cut(s) 287
ApoI RAATTY 1 cut(s) 268
AspS9I GGNCC 1 cut(s) 4
AvaII GGWCC 1 cut(s) 4
BaeGI GKGCMC 1 cut(s) 211
BbvI GCAGC 1 cut(s) 274
BccI CCATC 2 cut(s) 174, 226
BcuI ACTAGT 1 cut(s) 275
BfaI CTAG 1 cut(s) 276
BfmI CTRYAG 1 cut(s) 327
BisI GCNGC 1 cut(s) 288
BlsI GCNGC 1 cut(s) 289
Bme18I GGWCC 1 cut(s) 4
BmgT120I GGNCC 1 cut(s) 4
BsaJI CCNNGG 1 cut(s) 243
Bsc4I CCNNNNNNNGG 1 cut(s) 34
BseDI CCNNGG 1 cut(s) 243
BseLI CCNNNNNNNGG 1 cut(s) 34
BseMII CTCAG 1 cut(s) 300
BseRI GAGGAG 1 cut(s) 263
BseSI GKGCMC 1 cut(s) 211
BseXI GCAGC 1 cut(s) 274
BslI CCNNNNNNNGG 1 cut(s) 34
Bsp1286I GDGCHC 1 cut(s) 211
Bsp143I GATC 1 cut(s) 91
Bsp19I CCATGG 1 cut(s) 243
BspCNI CTCAG 1 cut(s) 301
BspHI TCATGA 1 cut(s) 67
BssECI CCNNGG 1 cut(s) 243
BssMI GATC 1 cut(s) 91
BssT1I CCWWGG 1 cut(s) 243
BstC8I GCNNGC 1 cut(s) 17
BstDEI CTNAG 3 cut(s) 85, 112, 309
BstDSI CCRYGG 1 cut(s) 243
BstKTI GATC 1 cut(s) 94
BstMBI GATC 1 cut(s) 91
BstNSI RCATGY 1 cut(s) 19
BstSFI CTRYAG 1 cut(s) 327
BstSLI GKGCMC 1 cut(s) 211
BstV1I GCAGC 1 cut(s) 274
BtgI CCRYGG 1 cut(s) 243
BtsIMutI CAGTG 1 cut(s) 306
Cac8I GCNNGC 1 cut(s) 17
CciI TCATGA 1 cut(s) 67
Cfr13I GGNCC 1 cut(s) 4
Csp6I GTAC 1 cut(s) 237
CviAII CATG 4 cut(s) 10, 16, 68, 244
CviJI RGCY 4 cut(s) 140, 190, 287, 313
CviKI_1 RGCY 4 cut(s) 140, 190, 287, 313
CviQI GTAC 1 cut(s) 237
DdeI CTNAG 3 cut(s) 85, 112, 309
DpnI GATC 1 cut(s) 93
DpnII GATC 1 cut(s) 91
DraI TTTAAA 1 cut(s) 55
Eco130I CCWWGG 1 cut(s) 243
Eco47I GGWCC 1 cut(s) 4
EcoT14I CCWWGG 1 cut(s) 243
ErhI CCWWGG 1 cut(s) 243
FaeI CATG 4 cut(s) 13, 19, 71, 247
FaiI YATR 7 cut(s) 11, 17, 47, 69, 245, 264, 284
FatI CATG 4 cut(s) 9, 15, 67, 243
FblI GTMKAC 1 cut(s) 330
Fnu4HI GCNGC 1 cut(s) 288
Fsp4HI GCNGC 1 cut(s) 288
FspBI CTAG 1 cut(s) 276
GluI GCNGC 1 cut(s) 288
Hin1II CATG 4 cut(s) 13, 19, 71, 247
HinfI GANTC 2 cut(s) 143, 226
Hpy166II GTNNAC 1 cut(s) 331
Hpy188I TCNGA 2 cut(s) 231, 301
Hpy188III TCNNGA 2 cut(s) 68, 169
Hpy8I GTNNAC 1 cut(s) 331
HpyAV CCTTC 1 cut(s) 344
HpyF3I CTNAG 3 cut(s) 85, 112, 309
Hsp92II CATG 4 cut(s) 13, 19, 71, 247
Kzo9I GATC 1 cut(s) 91
LmnI GCTCC 1 cut(s) 250
LpnPI CCDG 1 cut(s) 41
Lsp1109I GCAGC 1 cut(s) 274
MaeI CTAG 1 cut(s) 276
MalI GATC 1 cut(s) 93
MboI GATC 1 cut(s) 91
MhlI GDGCHC 1 cut(s) 211
MluCI AATT 2 cut(s) 63, 268
MnlI CCTC 5 cut(s) 124, 157, 180, 221, 241
MseI TTAA 3 cut(s) 54, 96, 272
MslI CAYNNNNRTG 1 cut(s) 14
NcoI CCATGG 1 cut(s) 243
NdeII GATC 1 cut(s) 91
NlaIII CATG 4 cut(s) 13, 19, 71, 247
NspI RCATGY 1 cut(s) 19
PaeI GCATGC 1 cut(s) 19
PagI TCATGA 1 cut(s) 67
PfeI GAWTC 2 cut(s) 143, 226
PkrI GCNGC 1 cut(s) 289
PspPI GGNCC 1 cut(s) 4
RsaI GTAC 1 cut(s) 238
RsaNI GTAC 1 cut(s) 237
RseI CAYNNNNRTG 1 cut(s) 14
SaqAI TTAA 3 cut(s) 54, 96, 272
SatI GCNGC 1 cut(s) 288
Sau3AI GATC 1 cut(s) 91
Sau96I GGNCC 1 cut(s) 4
SduI GDGCHC 1 cut(s) 211
SetI ASST 4 cut(s) 86, 168, 289, 336
SfcI CTRYAG 1 cut(s) 327
SinI GGWCC 1 cut(s) 4
SmiMI CAYNNNNRTG 1 cut(s) 14
SpeI ACTAGT 1 cut(s) 275
SphI GCATGC 1 cut(s) 19
Sse9I AATT 2 cut(s) 63, 268
SspI AATATT 1 cut(s) 156
SspMI CTAG 1 cut(s) 276
StyI CCWWGG 1 cut(s) 243
TaqI TCGA 1 cut(s) 129
TasI AATT 2 cut(s) 63, 268
TfiI GAWTC 2 cut(s) 143, 226
Tru1I TTAA 3 cut(s) 54, 96, 272
Tru9I TTAA 3 cut(s) 54, 96, 272
TscAI CASTG 1 cut(s) 313
TseI GCWGC 1 cut(s) 287
TspDTI ATGAA 3 cut(s) 56, 84, 360
TspRI CASTG 1 cut(s) 313
VpaK11BI GGWCC 1 cut(s) 4
XapI RAATTY 1 cut(s) 268
XceI RCATGY 1 cut(s) 19
XmiI GTMKAC 1 cut(s) 330
XspI CTAG 1 cut(s) 276
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.