Rh5BG497300

Microtubule associated protein (MAP65/ASE1 family)

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
Physical Location & Seq
Forward (+)
79259175 .. 79277559
18385 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG497300.1

Sequence Viewer

Length: 300 bp
ATGGTGGTGGAAGAGACCGACTTGTCCTTGAAAAGGCTAGAAGAACTACATAGGCAGTTGCTTGAATATCAAGATGAGAAGAGGAACCGTTTGAAGCTGATAATGGACCACATGAGCATGCTAAACTCCCTGTGCTTGGTTCTTGGTATGGATTTTAAACACACAATTCATGAAATCCACCCCACCTTAGATGATCTTAATGGAGAAAAAGATGTAGCGAACAGCACAATCGAGGGTTTGGCTAATTCGGTTCAAATATTGAGAGAGGTCAAGATACAGAGATGGCAGAAGGCTGATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

99

Amino Acids

11.62

Weight (kDa)

5.48

Isoelectric Point (pI)

42.95

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
MAP65_ASE1 PF03999 4 - 98 5.2e-08 Microtubule associated protein (MAP65/ASE1 family)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 22
AfiI CCNNNNNNNGG 2 cut(s) 33, 136
AgsI TTSAA 4 cut(s) 31, 65, 94, 254
AluBI AGCT 1 cut(s) 97
AluI AGCT 1 cut(s) 97
Alw26I GTCTC 1 cut(s) 8
AspS9I GGNCC 1 cut(s) 106
AvaII GGWCC 1 cut(s) 106
BccI CCATC 1 cut(s) 276
BcoDI GTCTC 1 cut(s) 8
BfaI CTAG 1 cut(s) 38
Bme18I GGWCC 1 cut(s) 106
BmgT120I GGNCC 1 cut(s) 106
BmiI GGNNCC 1 cut(s) 86
BsaI GGTCTC 1 cut(s) 8
Bsc4I CCNNNNNNNGG 2 cut(s) 33, 136
BseLI CCNNNNNNNGG 2 cut(s) 33, 136
BslI CCNNNNNNNGG 2 cut(s) 33, 136
BsmAI GTCTC 1 cut(s) 8
Bso31I GGTCTC 1 cut(s) 8
Bsp143I GATC 1 cut(s) 193
BspHI TCATGA 1 cut(s) 169
BspLI GGNNCC 1 cut(s) 86
BspTNI GGTCTC 1 cut(s) 8
BssMI GATC 1 cut(s) 193
Bst4CI ACNGT 1 cut(s) 89
Bst6I CTCTTC 2 cut(s) 6, 74
BstC8I GCNNGC 1 cut(s) 119
BstDEI CTNAG 1 cut(s) 187
BstENI CCTNNNNNAGG 1 cut(s) 31
BstKTI GATC 1 cut(s) 196
BstMAI GTCTC 1 cut(s) 8
BstMBI GATC 1 cut(s) 193
BstNSI RCATGY 1 cut(s) 121
Cac8I GCNNGC 1 cut(s) 119
CciI TCATGA 1 cut(s) 169
Cfr13I GGNCC 1 cut(s) 106
CviAII CATG 3 cut(s) 112, 118, 170
CviJI RGCY 4 cut(s) 37, 97, 242, 293
CviKI_1 RGCY 4 cut(s) 37, 97, 242, 293
DdeI CTNAG 1 cut(s) 187
DpnI GATC 1 cut(s) 195
DpnII GATC 1 cut(s) 193
DraI TTTAAA 1 cut(s) 157
DrdI GACNNNNNNGTC 1 cut(s) 22
DseDI GACNNNNNNGTC 1 cut(s) 22
Eam1104I CTCTTC 2 cut(s) 6, 74
EarI CTCTTC 2 cut(s) 6, 74
Eco31I GGTCTC 1 cut(s) 8
Eco47I GGWCC 1 cut(s) 106
EcoNI CCTNNNNNAGG 1 cut(s) 31
FaeI CATG 3 cut(s) 115, 121, 173
FaiI YATR 5 cut(s) 51, 113, 119, 149, 171
FatI CATG 3 cut(s) 111, 117, 169
FspBI CTAG 1 cut(s) 38
Hin1II CATG 3 cut(s) 115, 121, 173
Hpy188III TCNNGA 3 cut(s) 71, 170, 271
HpyAV CCTTC 1 cut(s) 283
HpyCH4III ACNGT 1 cut(s) 89
HpyF3I CTNAG 1 cut(s) 187
Hsp92II CATG 3 cut(s) 115, 121, 173
Kzo9I GATC 1 cut(s) 193
LpnPI CCDG 1 cut(s) 143
MaeI CTAG 1 cut(s) 38
MalI GATC 1 cut(s) 195
MboI GATC 1 cut(s) 193
MboII GAAGA 3 cut(s) 23, 53, 91
MluCI AATT 2 cut(s) 165, 244
MnlI CCTC 3 cut(s) 75, 226, 259
MseI TTAA 2 cut(s) 156, 198
MslI CAYNNNNRTG 1 cut(s) 116
NdeII GATC 1 cut(s) 193
NlaIII CATG 3 cut(s) 115, 121, 173
NlaIV GGNNCC 1 cut(s) 86
NspI RCATGY 1 cut(s) 121
PaeI GCATGC 1 cut(s) 121
PagI TCATGA 1 cut(s) 169
PspN4I GGNNCC 1 cut(s) 86
PspPI GGNCC 1 cut(s) 106
RseI CAYNNNNRTG 1 cut(s) 116
SaqAI TTAA 2 cut(s) 156, 198
Sau3AI GATC 1 cut(s) 193
Sau96I GGNCC 1 cut(s) 106
SetI ASST 3 cut(s) 99, 188, 270
SinI GGWCC 1 cut(s) 106
SmiMI CAYNNNNRTG 1 cut(s) 116
SphI GCATGC 1 cut(s) 121
Sse9I AATT 2 cut(s) 165, 244
SspI AATATT 1 cut(s) 258
SspMI CTAG 1 cut(s) 38
TaaI ACNGT 1 cut(s) 89
TaqI TCGA 1 cut(s) 231
TaqII GACCGA 1 cut(s) 32
TasI AATT 2 cut(s) 165, 244
Tru1I TTAA 2 cut(s) 156, 198
Tru9I TTAA 2 cut(s) 156, 198
TspDTI ATGAA 2 cut(s) 158, 186
VpaK11BI GGWCC 1 cut(s) 106
XagI CCTNNNNNAGG 1 cut(s) 31
XceI RCATGY 1 cut(s) 121
XspI CTAG 1 cut(s) 38
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.