Rmu_sc0003160.1_g000008

microtubule binding

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003160.1
Physical Location & Seq
Reverse (-)
23813 .. 26561
2749 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003160.1_g000008.1.cds

Sequence Viewer

Length: 603 bp
atgagcatgataaactccctgtgcttggttcttggtatggattttaaacgcacaattcatgaaatccaccccaccttagatgatcttaatggagaaaaagacttagcgaacagcacaatcgagggtttggctgattcggttcaaatattgagagaggtcaagatacagagatggcagagggttgaagctgaagtgtcaaagttggagcagcagggcaagtcaattaagctcaaagtgatccttctgaaaaagaagttggaactggaggaggtatgtagacagtctcacaaggttacagaaatactgagtgctgcaaaatactcaaatgaagctatagagtctggagctgtggaccctgcatgcctgttggaaaaaattgagcttcaaatcgcaagggcaaaagaggaagctccaagcaggaaagaaatactagaaaagattgaaaagtggttggctgcttgtcaagaagaatcctggctggaggagtacaatagggatgataatcgctatacagcaggaagaggtgctcatattactttgaaacgtgcagagaaagtgtgtgttttagcaaacaaaattcccggtaaagacttggttaaatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

200

Amino Acids

22.72

Weight (kDa)

6.47

Isoelectric Point (pI)

55.54

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 277
AclWI GGATC 1 cut(s) 232
AcsI RAATTY 1 cut(s) 576
AcuI CTGAAG 1 cut(s) 210
AfaI GTAC 1 cut(s) 488
AfiI CCNNNNNNNGG 1 cut(s) 25
AgsI TTSAA 5 cut(s) 143, 185, 386, 443, 541
AjnI CCWGG 1 cut(s) 473
AjuI GAANNNNNNNTTGG 2 cut(s) 239, 271
AluBI AGCT 6 cut(s) 188, 229, 332, 347, 382, 410
AluI AGCT 6 cut(s) 188, 229, 332, 347, 382, 410
Alw21I GWGCWC 1 cut(s) 529
Alw26I GTCTC 1 cut(s) 288
AlwI GGATC 1 cut(s) 232
ApeKI GCWGC 3 cut(s) 208, 311, 455
ApoI RAATTY 1 cut(s) 576
AspS9I GGNCC 1 cut(s) 352
AsuC2I CCSGG 1 cut(s) 582
AvaII GGWCC 1 cut(s) 352
Bbv12I GWGCWC 1 cut(s) 529
BbvI GCAGC 3 cut(s) 220, 298, 442
BccI CCATC 1 cut(s) 165
BciT130I CCWGG 1 cut(s) 475
BcnI CCSGG 1 cut(s) 582
BcoDI GTCTC 1 cut(s) 288
BfaI CTAG 1 cut(s) 431
BfmI CTRYAG 1 cut(s) 333
BisI GCNGC 3 cut(s) 209, 312, 456
BlsI GCNGC 3 cut(s) 210, 313, 457
Bme1390I CCNGG 2 cut(s) 475, 582
Bme18I GGWCC 1 cut(s) 352
BmgT120I GGNCC 1 cut(s) 352
BmiI GGNNCC 1 cut(s) 354
BmrFI CCNGG 2 cut(s) 475, 582
BpmI CTGGAG 3 cut(s) 284, 363, 500
BpuMI CCSGG 1 cut(s) 582
BsaBI GATNNNNATC 1 cut(s) 501
Bsc4I CCNNNNNNNGG 1 cut(s) 25
Bse1I ACTGG 1 cut(s) 267
Bse8I GATNNNNATC 1 cut(s) 501
BseBI CCWGG 1 cut(s) 475
BseGI GGATG 1 cut(s) 502
BseJI GATNNNNATC 1 cut(s) 501
BseLI CCNNNNNNNGG 1 cut(s) 25
BseMII CTCAG 1 cut(s) 296
BseNI ACTGG 1 cut(s) 267
BseRI GAGGAG 2 cut(s) 281, 497
BseXI GCAGC 3 cut(s) 220, 298, 442
BsgI GTGCAG 1 cut(s) 567
BsiHKAI GWGCWC 1 cut(s) 529
BsiSI CCGG 1 cut(s) 582
BslI CCNNNNNNNGG 1 cut(s) 25
BsmAI GTCTC 1 cut(s) 288
Bsp1286I GDGCHC 1 cut(s) 529
Bsp143I GATC 2 cut(s) 82, 237
BspCNI CTCAG 1 cut(s) 297
BspHI TCATGA 1 cut(s) 58
BspLI GGNNCC 1 cut(s) 354
BspPI GGATC 1 cut(s) 232
BsrI ACTGG 1 cut(s) 267
BssMI GATC 2 cut(s) 82, 237
Bst2UI CCWGG 1 cut(s) 475
Bst4CI ACNGT 1 cut(s) 282
Bst6I CTCTTC 1 cut(s) 514
BstC8I GCNNGC 1 cut(s) 361
BstDEI CTNAG 3 cut(s) 76, 103, 305
BstF5I GGATG 1 cut(s) 502
BstKTI GATC 2 cut(s) 85, 240
BstMAI GTCTC 1 cut(s) 288
BstMBI GATC 2 cut(s) 82, 237
BstNI CCWGG 1 cut(s) 475
BstNSI RCATGY 1 cut(s) 363
BstSCI CCNGG 2 cut(s) 473, 580
BstSFI CTRYAG 1 cut(s) 333
BstV1I GCAGC 3 cut(s) 220, 298, 442
BtsCI GGATG 1 cut(s) 502
Cac8I GCNNGC 1 cut(s) 361
CciI TCATGA 1 cut(s) 58
Cfr13I GGNCC 1 cut(s) 352
Csp6I GTAC 1 cut(s) 487
CviAII CATG 3 cut(s) 7, 59, 360
CviJI RGCY 9 cut(s) 131, 188, 229, 332, 347, 382, 410, 455, 478
CviKI_1 RGCY 9 cut(s) 131, 188, 229, 332, 347, 382, 410, 455, 478
CviQI GTAC 1 cut(s) 487
DdeI CTNAG 3 cut(s) 76, 103, 305
DpnI GATC 2 cut(s) 84, 239
DpnII GATC 2 cut(s) 82, 237
DraI TTTAAA 1 cut(s) 46
Eam1104I CTCTTC 1 cut(s) 514
EarI CTCTTC 1 cut(s) 514
Eco47I GGWCC 1 cut(s) 352
Eco57I CTGAAG 1 cut(s) 210
EcoRII CCWGG 1 cut(s) 473
FaeI CATG 3 cut(s) 10, 62, 363
FaiI YATR 8 cut(s) 8, 38, 60, 274, 335, 361, 510, 531
FalI AAGNNNNNCTT 2 cut(s) 225, 257
FatI CATG 3 cut(s) 6, 58, 359
FblI GTMKAC 1 cut(s) 277
Fnu4HI GCNGC 3 cut(s) 209, 312, 456
FokI GGATG 1 cut(s) 509
Fsp4HI GCNGC 3 cut(s) 209, 312, 456
FspBI CTAG 1 cut(s) 431
GluI GCNGC 3 cut(s) 209, 312, 456
GsuI CTGGAG 3 cut(s) 284, 363, 500
HapII CCGG 1 cut(s) 582
Hin1II CATG 3 cut(s) 10, 62, 363
HinfI GANTC 3 cut(s) 134, 338, 470
HpaII CCGG 1 cut(s) 582
Hpy166II GTNNAC 2 cut(s) 278, 352
Hpy188I TCNGA 1 cut(s) 246
Hpy188III TCNNGA 4 cut(s) 59, 160, 342, 464
Hpy8I GTNNAC 2 cut(s) 278, 352
HpyAV CCTTC 1 cut(s) 251
HpyCH4III ACNGT 1 cut(s) 282
HpyCH4IV ACGT 1 cut(s) 544
HpyCH4V TGCA 3 cut(s) 314, 359, 548
HpyF3I CTNAG 3 cut(s) 76, 103, 305
HpySE526I ACGT 1 cut(s) 544
Hsp92II CATG 3 cut(s) 10, 62, 363
Kzo9I GATC 2 cut(s) 82, 237
LmnI GCTCC 3 cut(s) 205, 344, 415
Lsp1109I GCAGC 3 cut(s) 220, 298, 442
MaeI CTAG 1 cut(s) 431
MaeII ACGT 1 cut(s) 544
MaeIII GTNAC 1 cut(s) 292
MalI GATC 2 cut(s) 84, 239
MboI GATC 2 cut(s) 82, 237
MboII GAAGA 2 cut(s) 479, 531
MhlI GDGCHC 1 cut(s) 529
MluCI AATT 4 cut(s) 54, 222, 375, 576
MlyI GAGTC 1 cut(s) 347
MmeI TCCRAC 3 cut(s) 183, 237, 348
MnlI CCTC 8 cut(s) 115, 148, 171, 259, 262, 397, 475, 515
MseI TTAA 4 cut(s) 45, 87, 225, 597
MspI CCGG 1 cut(s) 582
MspR9I CCNGG 2 cut(s) 475, 582
MvaI CCWGG 1 cut(s) 475
NciI CCSGG 1 cut(s) 582
NdeII GATC 2 cut(s) 82, 237
NlaIII CATG 3 cut(s) 10, 62, 363
NlaIV GGNNCC 1 cut(s) 354
NspI RCATGY 1 cut(s) 363
PaeI GCATGC 1 cut(s) 363
PagI TCATGA 1 cut(s) 58
PfeI GAWTC 2 cut(s) 134, 470
PkrI GCNGC 3 cut(s) 210, 313, 457
PleI GAGTC 1 cut(s) 346
PpsI GAGTC 1 cut(s) 346
Psp6I CCWGG 1 cut(s) 473
PspGI CCWGG 1 cut(s) 473
PspN4I GGNNCC 1 cut(s) 354
PspPI GGNCC 1 cut(s) 352
RsaI GTAC 1 cut(s) 488
RsaNI GTAC 1 cut(s) 487
SaqAI TTAA 4 cut(s) 45, 87, 225, 597
SatI GCNGC 3 cut(s) 209, 312, 456
Sau3AI GATC 2 cut(s) 82, 237
Sau96I GGNCC 1 cut(s) 352
SchI GAGTC 1 cut(s) 347
ScrFI CCNGG 2 cut(s) 475, 582
SduI GDGCHC 1 cut(s) 529
SfcI CTRYAG 1 cut(s) 333
SinI GGWCC 1 cut(s) 352
SphI GCATGC 1 cut(s) 363
Sse9I AATT 4 cut(s) 54, 222, 375, 576
SspI AATATT 1 cut(s) 147
SspMI CTAG 1 cut(s) 431
StyD4I CCNGG 2 cut(s) 473, 580
TaaI ACNGT 1 cut(s) 282
TaiI ACGT 1 cut(s) 547
TaqI TCGA 1 cut(s) 120
TasI AATT 4 cut(s) 54, 222, 375, 576
TatI WGTACW 1 cut(s) 486
TfiI GAWTC 2 cut(s) 134, 470
Tru1I TTAA 4 cut(s) 45, 87, 225, 597
Tru9I TTAA 4 cut(s) 45, 87, 225, 597
TseI GCWGC 3 cut(s) 208, 311, 455
TspDTI ATGAA 3 cut(s) 47, 75, 342
VpaK11BI GGWCC 1 cut(s) 352
XapI RAATTY 1 cut(s) 576
XceI RCATGY 1 cut(s) 363
XmiI GTMKAC 1 cut(s) 277
XspI CTAG 1 cut(s) 431
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.