Rh4BG240200

microtubule binding

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4B
OG0001938
Physical Location & Seq
Forward (+)
40663259 .. 40665120
1862 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4BG240200.1

Sequence Viewer

Length: 294 bp
ATGGAGGAGCAAAAGAAATATCAGAATGTAACTAGTCGCATAGCTGCTTCAAAATCTGAAATCACTGAGCCTAACATTCTTTCTGTAGACCTTCTAAATGATGTTGAAGCTGAAGTGTCAAAGTTGGAGCAGCTCAAGTCAATTAAGCTCAAAGAGATCCTTCTGAAAAAGAAGTTGGAACTGGAGGAGGTATGCAGACAGTCTCACATGGTTACAGAAATACCGAGTGCTGCAAAATACTCAAATGAAGCTATAGAGTCTGATCATATTGTTCAAATAAAGGATGGTGCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
MAP65_ASE1

Protein Analysis

97

Amino Acids

10.97

Weight (kDa)

5.22

Isoelectric Point (pI)

52.17

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
MAP65_ASE1 PF03999 18 - 88 1.2e-09 Microtubule associated protein (MAP65/ASE1 family)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 87
AclWI GGATC 1 cut(s) 151
AcuI CTGAAG 1 cut(s) 132
AgsI TTSAA 3 cut(s) 51, 107, 275
AhlI ACTAGT 1 cut(s) 32
AjuI GAANNNNNNNTTGG 2 cut(s) 158, 190
AluBI AGCT 5 cut(s) 44, 110, 133, 148, 251
AluI AGCT 5 cut(s) 44, 110, 133, 148, 251
Alw26I GTCTC 1 cut(s) 207
AlwI GGATC 1 cut(s) 151
ApeKI GCWGC 3 cut(s) 44, 130, 230
BbvI GCAGC 3 cut(s) 31, 142, 217
BccI CCATC 1 cut(s) 278
BclI TGATCA 1 cut(s) 262
BcoDI GTCTC 1 cut(s) 207
BcuI ACTAGT 1 cut(s) 32
BfaI CTAG 1 cut(s) 33
BfmI CTRYAG 2 cut(s) 84, 252
BisI GCNGC 3 cut(s) 45, 131, 231
BlsI GCNGC 3 cut(s) 46, 132, 232
BpmI CTGGAG 1 cut(s) 203
BpuEI CTTGAG 1 cut(s) 119
Bse1I ACTGG 1 cut(s) 186
BseGI GGATG 1 cut(s) 289
BseMII CTCAG 1 cut(s) 57
BseNI ACTGG 1 cut(s) 186
BseRI GAGGAG 2 cut(s) 20, 200
BseXI GCAGC 3 cut(s) 31, 142, 217
BsmAI GTCTC 1 cut(s) 207
Bsp143I GATC 2 cut(s) 156, 262
BspCNI CTCAG 1 cut(s) 58
BspPI GGATC 1 cut(s) 151
BsrI ACTGG 1 cut(s) 186
BssMI GATC 2 cut(s) 156, 262
Bst4CI ACNGT 1 cut(s) 201
BstDEI CTNAG 1 cut(s) 66
BstF5I GGATG 1 cut(s) 289
BstKTI GATC 2 cut(s) 159, 265
BstMAI GTCTC 1 cut(s) 207
BstMBI GATC 2 cut(s) 156, 262
BstSFI CTRYAG 2 cut(s) 84, 252
BstV1I GCAGC 3 cut(s) 31, 142, 217
BstX2I RGATCY 1 cut(s) 156
BstYI RGATCY 1 cut(s) 156
BtsCI GGATG 1 cut(s) 289
BtsIMutI CAGTG 1 cut(s) 63
CviAII CATG 1 cut(s) 208
CviJI RGCY 6 cut(s) 44, 70, 110, 133, 148, 251
CviKI_1 RGCY 6 cut(s) 44, 70, 110, 133, 148, 251
DdeI CTNAG 1 cut(s) 66
DpnI GATC 2 cut(s) 158, 264
DpnII GATC 2 cut(s) 156, 262
Eco57I CTGAAG 1 cut(s) 132
FaeI CATG 1 cut(s) 211
FaiI YATR 6 cut(s) 41, 193, 209, 254, 267, 292
FalI AAGNNNNNCTT 2 cut(s) 144, 176
FatI CATG 1 cut(s) 207
FbaI TGATCA 1 cut(s) 262
FblI GTMKAC 1 cut(s) 87
Fnu4HI GCNGC 3 cut(s) 45, 131, 231
Fsp4HI GCNGC 3 cut(s) 45, 131, 231
FspBI CTAG 1 cut(s) 33
GluI GCNGC 3 cut(s) 45, 131, 231
GsuI CTGGAG 1 cut(s) 203
Hin1II CATG 1 cut(s) 211
HinfI GANTC 1 cut(s) 257
Hpy166II GTNNAC 1 cut(s) 88
Hpy188I TCNGA 4 cut(s) 24, 58, 165, 262
Hpy8I GTNNAC 1 cut(s) 88
HpyAV CCTTC 2 cut(s) 101, 170
HpyCH4III ACNGT 1 cut(s) 201
HpyCH4V TGCA 3 cut(s) 195, 233, 290
HpyF3I CTNAG 1 cut(s) 66
Hsp92II CATG 1 cut(s) 211
Ksp22I TGATCA 1 cut(s) 262
Kzo9I GATC 2 cut(s) 156, 262
LmnI GCTCC 2 cut(s) 7, 127
LpnPI CCDG 1 cut(s) 167
Lsp1109I GCAGC 3 cut(s) 31, 142, 217
MaeI CTAG 1 cut(s) 33
MaeIII GTNAC 2 cut(s) 28, 211
MalI GATC 2 cut(s) 158, 264
MboI GATC 2 cut(s) 156, 262
MflI RGATCY 1 cut(s) 156
MluCI AATT 1 cut(s) 141
MlyI GAGTC 1 cut(s) 266
MmeI TCCRAC 2 cut(s) 105, 156
MnlI CCTC 2 cut(s) 178, 181
MseI TTAA 1 cut(s) 144
NdeII GATC 2 cut(s) 156, 262
NlaIII CATG 1 cut(s) 211
PkrI GCNGC 3 cut(s) 46, 132, 232
PleI GAGTC 1 cut(s) 265
PpsI GAGTC 1 cut(s) 265
PsuI RGATCY 1 cut(s) 156
SaqAI TTAA 1 cut(s) 144
SatI GCNGC 3 cut(s) 45, 131, 231
Sau3AI GATC 2 cut(s) 156, 262
SchI GAGTC 1 cut(s) 266
SetI ASST 7 cut(s) 46, 93, 112, 135, 150, 192, 253
SfcI CTRYAG 2 cut(s) 84, 252
SgeI CNNG 5 cut(s) 45, 148, 194, 220, 237
SmlI CTYRAG 1 cut(s) 134
SmoI CTYRAG 1 cut(s) 134
SpeI ACTAGT 1 cut(s) 32
Sse9I AATT 1 cut(s) 141
SspMI CTAG 1 cut(s) 33
TaaI ACNGT 1 cut(s) 201
TasI AATT 1 cut(s) 141
Tru1I TTAA 1 cut(s) 144
Tru9I TTAA 1 cut(s) 144
TscAI CASTG 1 cut(s) 70
TseI GCWGC 3 cut(s) 44, 130, 230
TspDTI ATGAA 1 cut(s) 261
TspRI CASTG 1 cut(s) 70
XmiI GTMKAC 1 cut(s) 87
XspI CTAG 1 cut(s) 33
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.