Rmu_co8074362.1_g000001

Mediator of RNA polymerase II transcription subunit 15a-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8074362.1
Physical Location & Seq
Reverse (-)
1 .. 421
421 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8074362.1_g000001.1.cds

Sequence Viewer

Length: 296 bp
atgttacaggtgaatcatctctttgaagaaattaccgctatcaaccaacaactaatagacactgttttagatattagagatggagagactattccatcagtagcctcagctccaattcttgatggtgaaggaaccattgttaggtgttccttcatcgctgtagctgttgcttctaatctgaagtctgaatgtgttccagctccaatgcttgcaatccagcctctgcgattgcttgttcctgcaaattatcctctgtgctctcctatatttatggacaagttgaaagtggaagtcag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

98

Amino Acids

10.63

Weight (kDa)

4.53

Isoelectric Point (pI)

39.82

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 36
AcuI CTGAAG 1 cut(s) 200
AfiI CCNNNNNNNGG 1 cut(s) 141
AgsI TTSAA 2 cut(s) 26, 283
AluBI AGCT 3 cut(s) 110, 164, 200
AluI AGCT 3 cut(s) 110, 164, 200
Alw21I GWGCWC 1 cut(s) 260
Alw26I GTCTC 1 cut(s) 80
AlwNI CAGNNNCTG 1 cut(s) 223
Asp700I GAANNNNTTC 1 cut(s) 192
AsuHPI GGTGA 2 cut(s) 22, 137
Bbv12I GWGCWC 1 cut(s) 260
BbvCI CCTCAGC 1 cut(s) 106
BccI CCATC 3 cut(s) 74, 103, 116
BcoDI GTCTC 1 cut(s) 80
BfmI CTRYAG 1 cut(s) 159
BmiI GGNNCC 1 cut(s) 133
Bpu10I CCTNAGC 1 cut(s) 106
Bsc4I CCNNNNNNNGG 1 cut(s) 141
BseLI CCNNNNNNNGG 1 cut(s) 141
BseMII CTCAG 1 cut(s) 120
BsiHKAI GWGCWC 1 cut(s) 260
BslI CCNNNNNNNGG 1 cut(s) 141
BsmAI GTCTC 1 cut(s) 80
Bsp1286I GDGCHC 1 cut(s) 260
BspACI CCGC 1 cut(s) 36
BspCNI CTCAG 1 cut(s) 119
BspLI GGNNCC 1 cut(s) 133
Bst4CI ACNGT 1 cut(s) 64
BstC8I GCNNGC 1 cut(s) 210
BstDEI CTNAG 1 cut(s) 106
BstMAI GTCTC 1 cut(s) 80
BstSFI CTRYAG 1 cut(s) 159
BtgZI GCGATG 1 cut(s) 139
BtsIMutI CAGTG 1 cut(s) 60
Cac8I GCNNGC 1 cut(s) 210
CaiI CAGNNNCTG 1 cut(s) 223
CviJI RGCY 5 cut(s) 104, 110, 164, 200, 220
CviKI_1 RGCY 5 cut(s) 104, 110, 164, 200, 220
DdeI CTNAG 1 cut(s) 106
Eco57I CTGAAG 1 cut(s) 200
FaiI YATR 2 cut(s) 266, 272
HinfI GANTC 1 cut(s) 13
HphI GGTGA 2 cut(s) 22, 137
Hpy188I TCNGA 2 cut(s) 180, 187
Hpy188III TCNNGA 1 cut(s) 119
HpyAV CCTTC 2 cut(s) 122, 160
HpyCH4III ACNGT 1 cut(s) 64
HpyCH4V TGCA 2 cut(s) 212, 242
HpyF3I CTNAG 1 cut(s) 106
LmnI GCTCC 2 cut(s) 115, 205
LpnPI CCDG 3 cut(s) 210, 230, 252
MaeIII GTNAC 1 cut(s) 3
MboII GAAGA 1 cut(s) 38
MhlI GDGCHC 1 cut(s) 260
MluCI AATT 3 cut(s) 30, 114, 244
MnlI CCTC 3 cut(s) 115, 231, 261
MroXI GAANNNNTTC 1 cut(s) 192
NlaIV GGNNCC 1 cut(s) 133
PdmI GAANNNNTTC 1 cut(s) 192
PfeI GAWTC 1 cut(s) 13
PspN4I GGNNCC 1 cut(s) 133
PstNI CAGNNNCTG 1 cut(s) 223
SduI GDGCHC 1 cut(s) 260
SetI ASST 5 cut(s) 12, 112, 146, 166, 202
SfcI CTRYAG 1 cut(s) 159
SgeI CNNG 8 cut(s) 20, 131, 209, 221, 229, 245, 251, 289
Sse9I AATT 3 cut(s) 30, 114, 244
SsiI CCGC 1 cut(s) 36
TaaI ACNGT 1 cut(s) 64
TasI AATT 3 cut(s) 30, 114, 244
TfiI GAWTC 1 cut(s) 13
TscAI CASTG 1 cut(s) 67
TspDTI ATGAA 1 cut(s) 142
TspRI CASTG 1 cut(s) 67
XmnI GAANNNNTTC 1 cut(s) 192
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.