Rmu_sc0028975.1_g000001

Mediator of RNA polymerase II transcription subunit 15a-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0028975.1
OG0001760
Physical Location & Seq
Reverse (-)
2 .. 359
358 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0028975.1_g000001.1.cds

Sequence Viewer

Length: 267 bp
atgaatgggccgacccctatcttagaagaaattactgctatcaaccaacaactaatagacactgttttagatattagagatggagagactattccatcaatagcctcagctccaattctcgatggtgaaggaaccattgttaggtgttccttcattgctgtagctgttgctcctaatctgaagtctgaatgtgttccagcaccaatgcttgcaatccagcctctgcgattgcttgttcctgcaaattatcctttgtgctctcctata
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
KIX_2

Protein Analysis

89

Amino Acids

9.4

Weight (kDa)

4.21

Isoelectric Point (pI)

46.47

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 200
AfiI CCNNNNNNNGG 1 cut(s) 141
AluBI AGCT 2 cut(s) 110, 164
AluI AGCT 2 cut(s) 110, 164
Alw21I GWGCWC 1 cut(s) 260
Alw26I GTCTC 1 cut(s) 80
AlwNI CAGNNNCTG 1 cut(s) 223
AoxI GGCC 1 cut(s) 8
Asp700I GAANNNNTTC 1 cut(s) 192
AspS9I GGNCC 1 cut(s) 8
AsuHPI GGTGA 1 cut(s) 137
Bbv12I GWGCWC 1 cut(s) 260
BbvCI CCTCAGC 1 cut(s) 106
BccI CCATC 3 cut(s) 74, 103, 116
BcoDI GTCTC 1 cut(s) 80
BfmI CTRYAG 1 cut(s) 159
BmgT120I GGNCC 1 cut(s) 8
BmiI GGNNCC 1 cut(s) 133
Bpu10I CCTNAGC 1 cut(s) 106
Bsc4I CCNNNNNNNGG 1 cut(s) 141
Bse3DI GCAATG 1 cut(s) 153
BseLI CCNNNNNNNGG 1 cut(s) 141
BseMI GCAATG 1 cut(s) 153
BseMII CTCAG 1 cut(s) 120
BshFI GGCC 1 cut(s) 10
BsiHKAI GWGCWC 1 cut(s) 260
BslI CCNNNNNNNGG 1 cut(s) 141
BsmAI GTCTC 1 cut(s) 80
BsnI GGCC 1 cut(s) 10
Bsp1286I GDGCHC 1 cut(s) 260
BspANI GGCC 1 cut(s) 10
BspCNI CTCAG 1 cut(s) 119
BspLI GGNNCC 1 cut(s) 133
BsrDI GCAATG 1 cut(s) 153
Bst4CI ACNGT 1 cut(s) 64
BstC8I GCNNGC 1 cut(s) 210
BstDEI CTNAG 2 cut(s) 22, 106
BstMAI GTCTC 1 cut(s) 80
BstSFI CTRYAG 1 cut(s) 159
BsuRI GGCC 1 cut(s) 10
BtsIMutI CAGTG 1 cut(s) 60
Cac8I GCNNGC 1 cut(s) 210
CaiI CAGNNNCTG 1 cut(s) 223
Cfr13I GGNCC 1 cut(s) 8
CviJI RGCY 5 cut(s) 10, 104, 110, 164, 220
CviKI_1 RGCY 5 cut(s) 10, 104, 110, 164, 220
DdeI CTNAG 2 cut(s) 22, 106
Eco57I CTGAAG 1 cut(s) 200
FaiI YATR 1 cut(s) 266
HaeIII GGCC 1 cut(s) 10
HphI GGTGA 1 cut(s) 137
Hpy188I TCNGA 2 cut(s) 180, 187
Hpy188III TCNNGA 1 cut(s) 119
HpyAV CCTTC 2 cut(s) 122, 160
HpyCH4III ACNGT 1 cut(s) 64
HpyCH4V TGCA 2 cut(s) 212, 242
HpyF3I CTNAG 2 cut(s) 22, 106
LmnI GCTCC 2 cut(s) 115, 175
LpnPI CCDG 3 cut(s) 210, 230, 252
MboII GAAGA 1 cut(s) 38
MhlI GDGCHC 1 cut(s) 260
MluCI AATT 3 cut(s) 30, 114, 244
MnlI CCTC 2 cut(s) 115, 231
MroXI GAANNNNTTC 1 cut(s) 192
NlaIV GGNNCC 1 cut(s) 133
PdmI GAANNNNTTC 1 cut(s) 192
PspN4I GGNNCC 1 cut(s) 133
PspPI GGNCC 1 cut(s) 8
PstNI CAGNNNCTG 1 cut(s) 223
Sau96I GGNCC 1 cut(s) 8
SduI GDGCHC 1 cut(s) 260
SetI ASST 3 cut(s) 112, 146, 166
SfcI CTRYAG 1 cut(s) 159
SgeI CNNG 6 cut(s) 131, 209, 221, 229, 245, 251
Sse9I AATT 3 cut(s) 30, 114, 244
TaaI ACNGT 1 cut(s) 64
TaqI TCGA 1 cut(s) 120
TasI AATT 3 cut(s) 30, 114, 244
TscAI CASTG 1 cut(s) 67
TspDTI ATGAA 2 cut(s) 17, 142
TspRI CASTG 1 cut(s) 67
XmnI GAANNNNTTC 1 cut(s) 192
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.