Rmu_sc0041275.1_g000001

Mediator of RNA polymerase II transcription subunit 15a-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0041275.1
Physical Location & Seq
Reverse (-)
1090 .. 1995
906 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0041275.1_g000001.1.cds

Sequence Viewer

Length: 420 bp
atgccaattagctatgaggcttcagaaaatagcagtataaatgatggcttgtcacagctaagtgatatggaaaattttgacttggactcacctgcaatatcttatagcaaacggcgtaggcttgaggtgaatcatctctttgaagaaattaccgctatcaaccaacaactaatagacactgttttagatattagagatggagagactattccatcagtagcctcagctccaattcttgatggtgaaggaaccattgttaggtgttccttcatcgctgtagctgttgcttctaatctgaagtctgaatgtgttccagctccaatgcttgcaatccagcctctgcgattgcttgttcctgcaaattatcctctgtgctctcctatatttatggacaagttgaaagtggaagtcaggtggtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

139

Amino Acids

15.35

Weight (kDa)

4.51

Isoelectric Point (pI)

56.44

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 100
Acc36I ACCTGC 1 cut(s) 100
AciI CCGC 1 cut(s) 153
AcsI RAATTY 1 cut(s) 73
AcuI CTGAAG 2 cut(s) 6, 317
AfiI CCNNNNNNNGG 1 cut(s) 258
AgsI TTSAA 2 cut(s) 143, 400
AluBI AGCT 5 cut(s) 12, 58, 227, 281, 317
AluI AGCT 5 cut(s) 12, 58, 227, 281, 317
Alw21I GWGCWC 1 cut(s) 377
Alw26I GTCTC 1 cut(s) 197
AlwNI CAGNNNCTG 1 cut(s) 340
ApoI RAATTY 1 cut(s) 73
Asp700I GAANNNNTTC 1 cut(s) 309
AsuHPI GGTGA 3 cut(s) 81, 139, 254
Bbv12I GWGCWC 1 cut(s) 377
BbvCI CCTCAGC 1 cut(s) 223
BccI CCATC 4 cut(s) 38, 191, 220, 233
BceAI ACGGC 1 cut(s) 128
BcoDI GTCTC 1 cut(s) 197
BfmI CTRYAG 1 cut(s) 276
BfuAI ACCTGC 1 cut(s) 100
BmiI GGNNCC 1 cut(s) 250
Bpu10I CCTNAGC 1 cut(s) 223
BpuEI CTTGAG 1 cut(s) 143
Bsc4I CCNNNNNNNGG 1 cut(s) 258
BseLI CCNNNNNNNGG 1 cut(s) 258
BseMII CTCAG 1 cut(s) 237
BsiHKAI GWGCWC 1 cut(s) 377
BslI CCNNNNNNNGG 1 cut(s) 258
BsmAI GTCTC 1 cut(s) 197
Bsp1286I GDGCHC 1 cut(s) 377
BspACI CCGC 1 cut(s) 153
BspCNI CTCAG 1 cut(s) 236
BspLI GGNNCC 1 cut(s) 250
BspMI ACCTGC 1 cut(s) 100
Bst4CI ACNGT 1 cut(s) 181
BstC8I GCNNGC 1 cut(s) 327
BstDEI CTNAG 2 cut(s) 59, 223
BstMAI GTCTC 1 cut(s) 197
BstSFI CTRYAG 1 cut(s) 276
BtgZI GCGATG 1 cut(s) 256
BtsIMutI CAGTG 1 cut(s) 177
BveI ACCTGC 1 cut(s) 100
Cac8I GCNNGC 1 cut(s) 327
CaiI CAGNNNCTG 1 cut(s) 340
DdeI CTNAG 2 cut(s) 59, 223
Eco57I CTGAAG 2 cut(s) 6, 317
FaiI YATR 6 cut(s) 15, 38, 68, 105, 383, 389
HinfI GANTC 2 cut(s) 86, 130
HphI GGTGA 3 cut(s) 81, 139, 254
Hpy188I TCNGA 3 cut(s) 25, 297, 304
Hpy188III TCNNGA 1 cut(s) 236
HpyAV CCTTC 2 cut(s) 239, 277
HpyCH4III ACNGT 1 cut(s) 181
HpyCH4V TGCA 3 cut(s) 95, 329, 359
HpyF3I CTNAG 2 cut(s) 59, 223
LmnI GCTCC 2 cut(s) 232, 322
LpnPI CCDG 5 cut(s) 105, 327, 347, 369, 397
MaeIII GTNAC 1 cut(s) 51
MboII GAAGA 1 cut(s) 155
MhlI GDGCHC 1 cut(s) 377
MluCI AATT 5 cut(s) 6, 73, 147, 231, 361
MlyI GAGTC 1 cut(s) 80
MnlI CCTC 5 cut(s) 10, 118, 232, 348, 378
MroXI GAANNNNTTC 1 cut(s) 309
NlaIV GGNNCC 1 cut(s) 250
NmuCI GTSAC 1 cut(s) 51
PaqCI CACCTGC 1 cut(s) 100
PdmI GAANNNNTTC 1 cut(s) 309
PfeI GAWTC 1 cut(s) 130
PleI GAGTC 1 cut(s) 80
PpsI GAGTC 1 cut(s) 80
PspN4I GGNNCC 1 cut(s) 250
PstNI CAGNNNCTG 1 cut(s) 340
SchI GAGTC 1 cut(s) 80
SduI GDGCHC 1 cut(s) 377
SetI ASST 9 cut(s) 14, 60, 94, 129, 229, 263, 283, 319, 416
SfcI CTRYAG 1 cut(s) 276
SmlI CTYRAG 1 cut(s) 122
SmoI CTYRAG 1 cut(s) 122
Sse9I AATT 5 cut(s) 6, 73, 147, 231, 361
SsiI CCGC 1 cut(s) 153
TaaI ACNGT 1 cut(s) 181
TasI AATT 5 cut(s) 6, 73, 147, 231, 361
TfiI GAWTC 1 cut(s) 130
TscAI CASTG 1 cut(s) 184
TseFI GTSAC 1 cut(s) 51
Tsp45I GTSAC 1 cut(s) 51
TspDTI ATGAA 1 cut(s) 259
TspRI CASTG 1 cut(s) 184
XapI RAATTY 1 cut(s) 73
XmnI GAANNNNTTC 1 cut(s) 309
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.