Rmu_sc0001380.1_g000009

Mediator of RNA polymerase II transcription subunit 15a-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001380.1
OG0001760
Physical Location & Seq
Forward (+)
50564 .. 50848
285 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001380.1_g000009.1.cds

Sequence Viewer

Length: 285 bp
atgtctggaccagataatgttcagagatctagagctgcgattggtgatttggaggacatgaccaattttcatttgcaggagagatactttgcctggcaggaaacaactgttggaacaaggataatgaagcgtcacagaagtatgccaattagctatggggcttcagaaaatagcagtataaatgatagcttgtcacatctaagtgatatggaaaatttagacttggactcacctgcaatatcttatagcaaacggcgtaggcttgaggtatgcgcggtgctttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
KIX_2

Protein Analysis

94

Amino Acids

10.71

Weight (kDa)

5.85

Isoelectric Point (pI)

67.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 241
Acc36I ACCTGC 1 cut(s) 241
AccII CGCG 1 cut(s) 275
AciI CCGC 1 cut(s) 275
AcsI RAATTY 1 cut(s) 214
AcuI CTGAAG 1 cut(s) 147
AjnI CCWGG 1 cut(s) 92
AjuI GAANNNNNNNTTGG 2 cut(s) 93, 125
AluBI AGCT 3 cut(s) 35, 153, 189
AluI AGCT 3 cut(s) 35, 153, 189
ApeKI GCWGC 1 cut(s) 35
ApoI RAATTY 1 cut(s) 214
AspLEI GCGC 1 cut(s) 275
AspS9I GGNCC 1 cut(s) 8
AsuHPI GGTGA 2 cut(s) 56, 222
AvaII GGWCC 1 cut(s) 8
BbvI GCAGC 1 cut(s) 22
BceAI ACGGC 1 cut(s) 269
BciT130I CCWGG 1 cut(s) 94
BfaI CTAG 1 cut(s) 30
BfuAI ACCTGC 1 cut(s) 241
BglII AGATCT 1 cut(s) 26
BisI GCNGC 1 cut(s) 36
BlsI GCNGC 1 cut(s) 37
Bme1390I CCNGG 1 cut(s) 94
Bme18I GGWCC 1 cut(s) 8
BmgT120I GGNCC 1 cut(s) 8
BmrFI CCNGG 1 cut(s) 94
BpuEI CTTGAG 1 cut(s) 284
BseBI CCWGG 1 cut(s) 94
BseXI GCAGC 1 cut(s) 22
Bsh1236I CGCG 1 cut(s) 275
Bsp143I GATC 1 cut(s) 26
BspACI CCGC 1 cut(s) 275
BspFNI CGCG 1 cut(s) 275
BspMI ACCTGC 1 cut(s) 241
BssMI GATC 1 cut(s) 26
Bst2UI CCWGG 1 cut(s) 94
Bst4CI ACNGT 1 cut(s) 109
BstDEI CTNAG 1 cut(s) 200
BstFNI CGCG 1 cut(s) 275
BstHHI GCGC 1 cut(s) 275
BstKTI GATC 1 cut(s) 29
BstMBI GATC 1 cut(s) 26
BstNI CCWGG 1 cut(s) 94
BstSCI CCNGG 1 cut(s) 92
BstUI CGCG 1 cut(s) 275
BstV1I GCAGC 1 cut(s) 22
BstX2I RGATCY 1 cut(s) 26
BstYI RGATCY 1 cut(s) 26
BveI ACCTGC 1 cut(s) 241
CfoI GCGC 1 cut(s) 275
Cfr13I GGNCC 1 cut(s) 8
CseI GACGC 1 cut(s) 119
CviAII CATG 1 cut(s) 58
CviJI RGCY 5 cut(s) 35, 153, 161, 189, 262
CviKI_1 RGCY 5 cut(s) 35, 153, 161, 189, 262
DdeI CTNAG 1 cut(s) 200
DpnI GATC 1 cut(s) 28
DpnII GATC 1 cut(s) 26
Eco47I GGWCC 1 cut(s) 8
Eco57I CTGAAG 1 cut(s) 147
EcoRII CCWGG 1 cut(s) 92
FaeI CATG 1 cut(s) 61
FaiI YATR 7 cut(s) 59, 143, 156, 179, 209, 246, 271
FatI CATG 1 cut(s) 57
Fnu4HI GCNGC 1 cut(s) 36
Fsp4HI GCNGC 1 cut(s) 36
FspBI CTAG 1 cut(s) 30
GlaI GCGC 1 cut(s) 274
GluI GCNGC 1 cut(s) 36
HgaI GACGC 1 cut(s) 119
HhaI GCGC 1 cut(s) 275
Hin1II CATG 1 cut(s) 61
Hin6I GCGC 1 cut(s) 273
HinP1I GCGC 1 cut(s) 273
HinfI GANTC 1 cut(s) 227
HphI GGTGA 2 cut(s) 56, 222
Hpy188I TCNGA 2 cut(s) 24, 166
Hpy188III TCNNGA 2 cut(s) 6, 30
HpyCH4III ACNGT 1 cut(s) 109
HpyCH4V TGCA 2 cut(s) 76, 236
HpyF3I CTNAG 1 cut(s) 200
Hsp92II CATG 1 cut(s) 61
HspAI GCGC 1 cut(s) 273
Kzo9I GATC 1 cut(s) 26
LpnPI CCDG 6 cut(s) 24, 62, 79, 83, 106, 246
Lsp1109I GCAGC 1 cut(s) 22
MaeI CTAG 1 cut(s) 30
MaeIII GTNAC 2 cut(s) 131, 192
MalI GATC 1 cut(s) 28
MboI GATC 1 cut(s) 26
MflI RGATCY 1 cut(s) 26
MluCI AATT 3 cut(s) 64, 147, 214
MlyI GAGTC 1 cut(s) 221
MmeI TCCRAC 1 cut(s) 91
MnlI CCTC 2 cut(s) 46, 259
MslI CAYNNNNRTG 1 cut(s) 201
MspR9I CCNGG 1 cut(s) 94
MvaI CCWGG 1 cut(s) 94
MvnI CGCG 1 cut(s) 275
NdeII GATC 1 cut(s) 26
NlaIII CATG 1 cut(s) 61
NmuCI GTSAC 2 cut(s) 131, 192
PaqCI CACCTGC 1 cut(s) 241
PkrI GCNGC 1 cut(s) 37
PleI GAGTC 1 cut(s) 221
PpsI GAGTC 1 cut(s) 221
Psp6I CCWGG 1 cut(s) 92
PspGI CCWGG 1 cut(s) 92
PspPI GGNCC 1 cut(s) 8
PsuI RGATCY 1 cut(s) 26
RseI CAYNNNNRTG 1 cut(s) 201
SatI GCNGC 1 cut(s) 36
Sau3AI GATC 1 cut(s) 26
Sau96I GGNCC 1 cut(s) 8
SchI GAGTC 1 cut(s) 221
ScrFI CCNGG 1 cut(s) 94
SetI ASST 5 cut(s) 37, 155, 191, 235, 270
SinI GGWCC 1 cut(s) 8
SmiMI CAYNNNNRTG 1 cut(s) 201
SmlI CTYRAG 1 cut(s) 263
SmoI CTYRAG 1 cut(s) 263
Sse9I AATT 3 cut(s) 64, 147, 214
SsiI CCGC 1 cut(s) 275
SspMI CTAG 1 cut(s) 30
StyD4I CCNGG 1 cut(s) 92
TaaI ACNGT 1 cut(s) 109
TasI AATT 3 cut(s) 64, 147, 214
TseFI GTSAC 2 cut(s) 131, 192
TseI GCWGC 1 cut(s) 35
Tsp45I GTSAC 2 cut(s) 131, 192
TspDTI ATGAA 2 cut(s) 59, 140
VpaK11BI GGWCC 1 cut(s) 8
XapI RAATTY 1 cut(s) 214
XbaI TCTAGA 1 cut(s) 29
XspI CTAG 1 cut(s) 30
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.