Rmu_co8250369.1_g000001

CBL-interacting serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8250369.1
Physical Location & Seq
Reverse (-)
1 .. 772
772 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8250369.1_g000001.1.cds

Sequence Viewer

Length: 387 bp
atgtttatgatgcagatcaagagggagatatccataatgaagcttgtgaggcatccctatgtagttcgtttgcacgaggttctagcgagtcggaccaagatttatataatattggagttcattacgggtggtgaattgtttgataaaatcgttcatcacggacgtcttagcgaagctgaagccaggagattcttccaacagcttattgatggagtggattattgccacagcaagggagtgtatcatagagatttaaagccggaaaatcttttgcttgattctcttggaaatttaagaatttcagatttcggtctgagtgcattgcctgaacaaggagtcagcctccttcgcacaacttgtgggacccctaactatgttgcacctgag

Protein Analysis

129

Amino Acids

14.81

Weight (kDa)

7.85

Isoelectric Point (pI)

31.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 166
AcsI RAATTY 2 cut(s) 289, 297
AcuI CTGAAG 1 cut(s) 198
AcyI GRCGYC 1 cut(s) 163
AfiI CCNNNNNNNGG 2 cut(s) 232, 332
AjnI CCWGG 1 cut(s) 182
AluBI AGCT 3 cut(s) 43, 176, 202
AluI AGCT 3 cut(s) 43, 176, 202
ApoI RAATTY 2 cut(s) 289, 297
AspS9I GGNCC 2 cut(s) 93, 363
AsuHPI GGTGA 1 cut(s) 143
AvaII GGWCC 2 cut(s) 93, 363
BauI CACGAG 1 cut(s) 74
BccI CCATC 1 cut(s) 203
BciT130I CCWGG 1 cut(s) 184
BfaI CTAG 1 cut(s) 83
Bme1390I CCNGG 1 cut(s) 184
Bme18I GGWCC 2 cut(s) 93, 363
BmgT120I GGNCC 2 cut(s) 93, 363
BmiI GGNNCC 2 cut(s) 364, 365
BmrFI CCNGG 1 cut(s) 184
BmsI GCATC 1 cut(s) 61
BplI GAGNNNNNCTC 2 cut(s) 327, 359
BsaBI GATNNNNATC 1 cut(s) 14
BsaHI GRCGYC 1 cut(s) 163
Bsc4I CCNNNNNNNGG 2 cut(s) 232, 332
Bse3DI GCAATG 1 cut(s) 320
Bse8I GATNNNNATC 1 cut(s) 14
BseBI CCWGG 1 cut(s) 184
BseGI GGATG 1 cut(s) 52
BseJI GATNNNNATC 1 cut(s) 14
BseLI CCNNNNNNNGG 2 cut(s) 232, 332
BseMI GCAATG 1 cut(s) 320
BseMII CTCAG 2 cut(s) 305, 375
BsiSI CCGG 1 cut(s) 260
BslFI GGGAC 1 cut(s) 376
BslI CCNNNNNNNGG 2 cut(s) 232, 332
BsmFI GGGAC 1 cut(s) 376
Bsp143I GATC 1 cut(s) 15
BspCNI CTCAG 2 cut(s) 306, 376
BspLI GGNNCC 2 cut(s) 364, 365
BsrDI GCAATG 1 cut(s) 320
BssMI GATC 1 cut(s) 15
BssNI GRCGYC 1 cut(s) 163
BssSI CACGAG 1 cut(s) 74
Bst2BI CACGAG 1 cut(s) 74
Bst2UI CCWGG 1 cut(s) 184
BstACI GRCGYC 1 cut(s) 163
BstDEI CTNAG 3 cut(s) 167, 314, 384
BstENI CCTNNNNNAGG 1 cut(s) 330
BstF5I GGATG 1 cut(s) 52
BstKTI GATC 1 cut(s) 18
BstMBI GATC 1 cut(s) 15
BstMWI GCNNNNNNNGC 2 cut(s) 49, 348
BstNI CCWGG 1 cut(s) 184
BstSCI CCNGG 1 cut(s) 182
BtsCI GGATG 1 cut(s) 52
Cfr13I GGNCC 2 cut(s) 93, 363
CviJI RGCY 6 cut(s) 43, 176, 182, 202, 259, 342
CviKI_1 RGCY 6 cut(s) 43, 176, 182, 202, 259, 342
DdeI CTNAG 3 cut(s) 167, 314, 384
DpnI GATC 1 cut(s) 17
DpnII GATC 1 cut(s) 15
DraI TTTAAA 1 cut(s) 255
Eco32I GATATC 1 cut(s) 30
Eco47I GGWCC 2 cut(s) 93, 363
Eco57I CTGAAG 1 cut(s) 198
EcoNI CCTNNNNNAGG 1 cut(s) 330
EcoO109I RGGNCCY 1 cut(s) 363
EcoRII CCWGG 1 cut(s) 182
EcoRV GATATC 1 cut(s) 30
FaiI YATR 7 cut(s) 8, 35, 60, 105, 107, 246, 375
FaqI GGGAC 1 cut(s) 376
FokI GGATG 1 cut(s) 39
FspBI CTAG 1 cut(s) 83
HapII CCGG 1 cut(s) 260
Hin1I GRCGYC 1 cut(s) 163
HindIII AAGCTT 1 cut(s) 41
HinfI GANTC 4 cut(s) 88, 189, 278, 336
HpaII CCGG 1 cut(s) 260
HphI GGTGA 1 cut(s) 143
Hpy188I TCNGA 3 cut(s) 93, 304, 315
Hpy188III TCNNGA 1 cut(s) 19
HpyAV CCTTC 1 cut(s) 356
HpyCH4IV ACGT 1 cut(s) 163
HpyCH4V TGCA 4 cut(s) 13, 73, 320, 380
HpyF10VI GCNNNNNNNGC 2 cut(s) 49, 348
HpyF3I CTNAG 3 cut(s) 167, 314, 384
HpySE526I ACGT 1 cut(s) 163
Hsp92I GRCGYC 1 cut(s) 163
KflI GGGWCCC 1 cut(s) 363
Kzo9I GATC 1 cut(s) 15
LpnPI CCDG 4 cut(s) 169, 196, 273, 339
LweI GCATC 1 cut(s) 61
MaeI CTAG 1 cut(s) 83
MaeII ACGT 1 cut(s) 163
MalI GATC 1 cut(s) 17
MboI GATC 1 cut(s) 15
MboII GAAGA 1 cut(s) 184
MluCI AATT 3 cut(s) 134, 289, 297
MlyI GAGTC 2 cut(s) 97, 345
MmeI TCCRAC 2 cut(s) 71, 220
MnlI CCTC 4 cut(s) 15, 42, 70, 353
MseI TTAA 2 cut(s) 254, 293
MslI CAYNNNNRTG 1 cut(s) 57
MspI CCGG 1 cut(s) 260
MspR9I CCNGG 1 cut(s) 184
MvaI CCWGG 1 cut(s) 184
MwoI GCNNNNNNNGC 2 cut(s) 49, 348
NdeII GATC 1 cut(s) 15
NlaIV GGNNCC 2 cut(s) 364, 365
PfeI GAWTC 2 cut(s) 189, 278
PleI GAGTC 2 cut(s) 96, 344
PpsI GAGTC 2 cut(s) 96, 344
PpuMI RGGWCCY 1 cut(s) 363
Psp5II RGGWCCY 1 cut(s) 363
Psp6I CCWGG 1 cut(s) 182
PspGI CCWGG 1 cut(s) 182
PspN4I GGNNCC 2 cut(s) 364, 365
PspPI GGNCC 2 cut(s) 93, 363
PspPPI RGGWCCY 1 cut(s) 363
RseI CAYNNNNRTG 1 cut(s) 57
SaqAI TTAA 2 cut(s) 254, 293
Sau3AI GATC 1 cut(s) 15
Sau96I GGNCC 2 cut(s) 93, 363
SchI GAGTC 2 cut(s) 97, 345
ScrFI CCNGG 1 cut(s) 184
SetI ASST 6 cut(s) 45, 81, 166, 178, 204, 385
SfaNI GCATC 1 cut(s) 61
SinI GGWCC 2 cut(s) 93, 363
SmiMI CAYNNNNRTG 1 cut(s) 57
Sse9I AATT 3 cut(s) 134, 289, 297
SspI AATATT 1 cut(s) 111
SspMI CTAG 1 cut(s) 83
StyD4I CCNGG 1 cut(s) 182
TaiI ACGT 1 cut(s) 166
TaqII GACCGA 1 cut(s) 299
TasI AATT 3 cut(s) 134, 289, 297
TfiI GAWTC 2 cut(s) 189, 278
Tru1I TTAA 2 cut(s) 254, 293
Tru9I TTAA 2 cut(s) 254, 293
TspDTI ATGAA 3 cut(s) 53, 109, 143
TspGWI ACGGA 1 cut(s) 174
VpaK11BI GGWCC 2 cut(s) 93, 363
XagI CCTNNNNNAGG 1 cut(s) 330
XapI RAATTY 2 cut(s) 289, 297
XspI CTAG 1 cut(s) 83
ZraI GACGTC 1 cut(s) 164
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.