Rmu_co8438113.1_g000001

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8438113.1
OG0000926
Physical Location & Seq
Forward (+)
1 .. 1374
1374 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8438113.1_g000001.1.cds

Sequence Viewer

Length: 588 bp
agctctttgaaagatgatggtacagataaaagcagagaaagccttgatgagggaaagacagtattaataaaggaagcaattggagaagaagcaaaggatgcattgggtgaacctgaggtacgtgctggttcttgtgagggtgttttttgtgttggtaaagacactgtggcagccgaaaatggtgccaatgctgaattgggtgtaaaagaggtattcgatgatcatcagattaacagtgaaaataaaatgatttgtcagaacttgttgaaagatgatggtacaacagaaaacacagaagccctcaacaagggaatatcagaagtcgaagcaaacaaagaagatggagtggatacaggggttgaagttccggaaaatgctgatgattacaagcatgatttagttgtttccaaagaaacattggattctaccagtggatatactggtgaaataggctcaaaggtggaacctgaggtagccttaggtgatggaacaccaatggcatgtgagttgcaggctgaacctgagaaaaatgtggatggtcccaatgatgatttaaatgtctttttggagaatttagaacccctgtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

195

Amino Acids

20.76

Weight (kDa)

4.1

Isoelectric Point (pI)

27.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 182
AccIII TCCGGA 1 cut(s) 367
AcsI RAATTY 1 cut(s) 571
AfaI GTAC 3 cut(s) 22, 120, 280
AfiI CCNNNNNNNGG 2 cut(s) 49, 307
AgsI TTSAA 3 cut(s) 10, 268, 362
AluBI AGCT 1 cut(s) 3
AluI AGCT 1 cut(s) 3
Aor13HI TCCGGA 1 cut(s) 367
ApeKI GCWGC 1 cut(s) 170
ApoI RAATTY 1 cut(s) 571
AseI ATTAAT 1 cut(s) 65
AspS9I GGNCC 1 cut(s) 539
AsuHPI GGTGA 3 cut(s) 119, 455, 494
AvaII GGWCC 1 cut(s) 539
AxyI CCTNAGG 3 cut(s) 114, 468, 478
BaeI ACNNNNGTAYC 2 cut(s) 342, 375
BanI GGYRCC 1 cut(s) 182
BbvI GCAGC 1 cut(s) 182
BccI CCATC 5 cut(s) 11, 269, 335, 479, 530
BcgI CGANNNNNNTGC 2 cut(s) 164, 198
BciVI GTATCC 1 cut(s) 343
BclI TGATCA 1 cut(s) 220
BfuI GTATCC 1 cut(s) 343
BisI GCNGC 1 cut(s) 171
BlsI GCNGC 1 cut(s) 172
Bme18I GGWCC 1 cut(s) 539
BmgT120I GGNCC 1 cut(s) 539
BmiI GGNNCC 3 cut(s) 184, 465, 541
BmsI GCATC 1 cut(s) 88
BsaAI YACGTR 1 cut(s) 122
BsaBI GATNNNNATC 1 cut(s) 222
BsaWI WCCGGW 1 cut(s) 367
Bsc4I CCNNNNNNNGG 2 cut(s) 49, 307
Bse1I ACTGG 2 cut(s) 429, 445
Bse21I CCTNAGG 3 cut(s) 114, 468, 478
Bse8I GATNNNNATC 1 cut(s) 222
BseAI TCCGGA 1 cut(s) 367
BseGI GGATG 2 cut(s) 103, 541
BseJI GATNNNNATC 1 cut(s) 222
BseLI CCNNNNNNNGG 2 cut(s) 49, 307
BseMII CTCAG 3 cut(s) 105, 459, 513
BseNI ACTGG 2 cut(s) 429, 445
BseXI GCAGC 1 cut(s) 182
BshNI GGYRCC 1 cut(s) 182
BsiSI CCGG 1 cut(s) 368
BslFI GGGAC 1 cut(s) 525
BslI CCNNNNNNNGG 2 cut(s) 49, 307
BsmFI GGGAC 1 cut(s) 525
Bsp13I TCCGGA 1 cut(s) 367
Bsp143I GATC 1 cut(s) 220
BspCNI CTCAG 3 cut(s) 106, 460, 514
BspEI TCCGGA 1 cut(s) 367
BspLI GGNNCC 3 cut(s) 184, 465, 541
BspT107I GGYRCC 1 cut(s) 182
BsrI ACTGG 2 cut(s) 429, 445
BssMI GATC 1 cut(s) 220
Bst4CI ACNGT 3 cut(s) 61, 166, 236
BstAPI GCANNNNNTGC 1 cut(s) 98
BstBAI YACGTR 1 cut(s) 122
BstC8I GCNNGC 1 cut(s) 513
BstDEI CTNAG 4 cut(s) 114, 468, 478, 522
BstENI CCTNNNNNAGG 2 cut(s) 47, 305
BstF5I GGATG 2 cut(s) 103, 541
BstKTI GATC 1 cut(s) 223
BstMBI GATC 1 cut(s) 220
BstMWI GCNNNNNNNGC 2 cut(s) 39, 98
BstNSI RCATGY 1 cut(s) 504
BstV1I GCAGC 1 cut(s) 182
Bsu36I CCTNAGG 3 cut(s) 114, 468, 478
BsuI GTATCC 1 cut(s) 343
BtsCI GGATG 2 cut(s) 103, 541
BtsIMutI CAGTG 3 cut(s) 162, 241, 436
Cac8I GCNNGC 1 cut(s) 513
Cfr13I GGNCC 1 cut(s) 539
Csp6I GTAC 3 cut(s) 21, 119, 279
CviAII CATG 2 cut(s) 392, 501
CviJI RGCY 7 cut(s) 3, 42, 173, 299, 453, 476, 515
CviKI_1 RGCY 7 cut(s) 3, 42, 173, 299, 453, 476, 515
CviQI GTAC 3 cut(s) 21, 119, 279
DdeI CTNAG 4 cut(s) 114, 468, 478, 522
DpnI GATC 1 cut(s) 222
DpnII GATC 1 cut(s) 220
DraI TTTAAA 1 cut(s) 555
Eco47I GGWCC 1 cut(s) 539
Eco81I CCTNAGG 3 cut(s) 114, 468, 478
EcoNI CCTNNNNNAGG 2 cut(s) 47, 305
EcoT22I ATGCAT 1 cut(s) 103
FaeI CATG 2 cut(s) 395, 504
FaiI YATR 3 cut(s) 393, 438, 502
FaqI GGGAC 1 cut(s) 525
FatI CATG 2 cut(s) 391, 500
FbaI TGATCA 1 cut(s) 220
Fnu4HI GCNGC 1 cut(s) 171
FokI GGATG 2 cut(s) 110, 548
Fsp4HI GCNGC 1 cut(s) 171
GluI GCNGC 1 cut(s) 171
HapII CCGG 1 cut(s) 368
Hin1II CATG 2 cut(s) 395, 504
HinfI GANTC 1 cut(s) 422
HpaII CCGG 1 cut(s) 368
HphI GGTGA 3 cut(s) 119, 455, 494
Hpy166II GTNNAC 1 cut(s) 110
Hpy188I TCNGA 3 cut(s) 228, 258, 319
Hpy188III TCNNGA 1 cut(s) 368
Hpy8I GTNNAC 1 cut(s) 110
HpyCH4III ACNGT 3 cut(s) 61, 166, 236
HpyCH4IV ACGT 1 cut(s) 121
HpyCH4V TGCA 2 cut(s) 101, 511
HpyF10VI GCNNNNNNNGC 2 cut(s) 39, 98
HpyF3I CTNAG 4 cut(s) 114, 468, 478, 522
HpySE526I ACGT 1 cut(s) 121
Hsp92II CATG 2 cut(s) 395, 504
Kpn2I TCCGGA 1 cut(s) 367
Ksp22I TGATCA 1 cut(s) 220
Kzo9I GATC 1 cut(s) 220
LpnPI CCDG 9 cut(s) 111, 126, 339, 381, 426, 442, 480, 497, 534
Lsp1109I GCAGC 1 cut(s) 182
LweI GCATC 1 cut(s) 88
MaeII ACGT 1 cut(s) 121
MalI GATC 1 cut(s) 222
MboI GATC 1 cut(s) 220
MboII GAAGA 2 cut(s) 98, 350
MfeI CAATTG 1 cut(s) 78
MluCI AATT 3 cut(s) 78, 194, 571
MnlI CCTC 6 cut(s) 43, 109, 130, 202, 311, 463
Mph1103I ATGCAT 1 cut(s) 103
MroI TCCGGA 1 cut(s) 367
MseI TTAA 3 cut(s) 65, 231, 554
MspI CCGG 1 cut(s) 368
MunI CAATTG 1 cut(s) 78
MwoI GCNNNNNNNGC 2 cut(s) 39, 98
NdeII GATC 1 cut(s) 220
NlaIII CATG 2 cut(s) 395, 504
NlaIV GGNNCC 3 cut(s) 184, 465, 541
NsiI ATGCAT 1 cut(s) 103
NspI RCATGY 1 cut(s) 504
PfeI GAWTC 1 cut(s) 422
PkrI GCNGC 1 cut(s) 172
Ppu21I YACGTR 1 cut(s) 122
PshBI ATTAAT 1 cut(s) 65
PspN4I GGNNCC 3 cut(s) 184, 465, 541
PspPI GGNCC 1 cut(s) 539
PsrI GAACNNNNNNTAC 2 cut(s) 102, 134
RsaI GTAC 3 cut(s) 22, 120, 280
RsaNI GTAC 3 cut(s) 21, 119, 279
SaqAI TTAA 3 cut(s) 65, 231, 554
SatI GCNGC 1 cut(s) 171
Sau3AI GATC 1 cut(s) 220
Sau96I GGNCC 1 cut(s) 539
SetI ASST 9 cut(s) 115, 120, 124, 213, 462, 469, 474, 484, 523
SfaNI GCATC 1 cut(s) 88
SinI GGWCC 1 cut(s) 539
SmiI ATTTAAAT 1 cut(s) 555
Sse9I AATT 3 cut(s) 78, 194, 571
SwaI ATTTAAAT 1 cut(s) 555
TaaI ACNGT 3 cut(s) 61, 166, 236
TaiI ACGT 1 cut(s) 124
TaqI TCGA 2 cut(s) 216, 324
TasI AATT 3 cut(s) 78, 194, 571
TfiI GAWTC 1 cut(s) 422
Tru1I TTAA 3 cut(s) 65, 231, 554
Tru9I TTAA 3 cut(s) 65, 231, 554
TscAI CASTG 3 cut(s) 169, 241, 436
TseI GCWGC 1 cut(s) 170
TspRI CASTG 3 cut(s) 169, 241, 436
VpaK11BI GGWCC 1 cut(s) 539
VspI ATTAAT 1 cut(s) 65
XagI CCTNNNNNAGG 2 cut(s) 47, 305
XapI RAATTY 1 cut(s) 571
XceI RCATGY 1 cut(s) 504
XcmI CCANNNNNNNNNTGG 2 cut(s) 193, 415
Zsp2I ATGCAT 1 cut(s) 103
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.