Rmu_co8450373.1_g000001

gamma-irradiation and mitomycin c induced

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8450373.1
Physical Location & Seq
Forward (+)
1 .. 944
944 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8450373.1_g000001.1.cds

Sequence Viewer

Length: 248 bp
tatcaatttatgtctactccaacaatgatgttttactgaatcttcagtctcaaactgagaaaagggtgttgatgatttcatcaaaggtgcctgacgtttgcgtggctggtactcaaatggaaaatatggtttttgaaattgtcagccttgatgttgttgatgatactattcagcatgttgataaaagtggccaattacatatagctacaataatgggcggttcatcatccatggaggaatccctttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

81

Amino Acids

8.89

Weight (kDa)

4.33

Isoelectric Point (pI)

39.86

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 87
AccI GTMKAC 1 cut(s) 14
AciI CCGC 1 cut(s) 218
AcoI YGGCCR 1 cut(s) 189
AcuI CTGAAG 1 cut(s) 28
AfaI GTAC 1 cut(s) 111
AgsI TTSAA 1 cut(s) 136
AluBI AGCT 1 cut(s) 205
AluI AGCT 1 cut(s) 205
Alw26I GTCTC 1 cut(s) 53
AoxI GGCC 1 cut(s) 189
BalI TGGCCA 1 cut(s) 191
BanI GGYRCC 1 cut(s) 87
BcoDI GTCTC 1 cut(s) 53
BmiI GGNNCC 1 cut(s) 89
BsaJI CCNNGG 1 cut(s) 230
BseDI CCNNGG 1 cut(s) 230
BseGI GGATG 1 cut(s) 226
BseMII CTCAG 1 cut(s) 47
BshFI GGCC 1 cut(s) 191
BshNI GGYRCC 1 cut(s) 87
BsmAI GTCTC 1 cut(s) 53
BsnI GGCC 1 cut(s) 191
Bsp19I CCATGG 1 cut(s) 230
BspACI CCGC 1 cut(s) 218
BspANI GGCC 1 cut(s) 191
BspCNI CTCAG 1 cut(s) 48
BspLI GGNNCC 1 cut(s) 89
BspT107I GGYRCC 1 cut(s) 87
BssECI CCNNGG 1 cut(s) 230
BssT1I CCWWGG 1 cut(s) 230
BstDEI CTNAG 1 cut(s) 56
BstDSI CCRYGG 1 cut(s) 230
BstF5I GGATG 1 cut(s) 226
BstMAI GTCTC 1 cut(s) 53
BstNSI RCATGY 1 cut(s) 178
BsuRI GGCC 1 cut(s) 191
BtgI CCRYGG 1 cut(s) 230
BtsCI GGATG 1 cut(s) 226
Csp6I GTAC 1 cut(s) 110
CviAII CATG 2 cut(s) 175, 231
CviJI RGCY 4 cut(s) 106, 146, 191, 205
CviKI_1 RGCY 4 cut(s) 106, 146, 191, 205
CviQI GTAC 1 cut(s) 110
DdeI CTNAG 1 cut(s) 56
EaeI YGGCCR 1 cut(s) 189
Eco130I CCWWGG 1 cut(s) 230
Eco57I CTGAAG 1 cut(s) 28
EcoT14I CCWWGG 1 cut(s) 230
ErhI CCWWGG 1 cut(s) 230
FaeI CATG 2 cut(s) 178, 234
FaiI YATR 6 cut(s) 11, 127, 176, 200, 202, 232
FatI CATG 2 cut(s) 174, 230
FblI GTMKAC 1 cut(s) 14
FokI GGATG 1 cut(s) 213
HaeIII GGCC 1 cut(s) 191
Hin1II CATG 2 cut(s) 178, 234
HinfI GANTC 2 cut(s) 39, 238
Hpy166II GTNNAC 1 cut(s) 15
Hpy8I GTNNAC 1 cut(s) 15
HpyCH4IV ACGT 1 cut(s) 95
HpyF3I CTNAG 1 cut(s) 56
HpySE526I ACGT 1 cut(s) 95
Hsp92II CATG 2 cut(s) 178, 234
LpnPI CCDG 2 cut(s) 92, 104
MaeII ACGT 1 cut(s) 95
MboII GAAGA 1 cut(s) 34
MlsI TGGCCA 1 cut(s) 191
MluCI AATT 3 cut(s) 5, 137, 193
MluNI TGGCCA 1 cut(s) 191
MmeI TCCRAC 1 cut(s) 44
MnlI CCTC 1 cut(s) 228
Mox20I TGGCCA 1 cut(s) 191
MscI TGGCCA 1 cut(s) 191
Msp20I TGGCCA 1 cut(s) 191
NcoI CCATGG 1 cut(s) 230
NlaIII CATG 2 cut(s) 178, 234
NlaIV GGNNCC 1 cut(s) 89
NspI RCATGY 1 cut(s) 178
PfeI GAWTC 2 cut(s) 39, 238
PspN4I GGNNCC 1 cut(s) 89
RsaI GTAC 1 cut(s) 111
RsaNI GTAC 1 cut(s) 110
SetI ASST 3 cut(s) 89, 98, 207
SgeI CNNG 6 cut(s) 103, 114, 119, 160, 187, 243
Sse9I AATT 3 cut(s) 5, 137, 193
SsiI CCGC 1 cut(s) 218
StyI CCWWGG 1 cut(s) 230
TaiI ACGT 1 cut(s) 98
TasI AATT 3 cut(s) 5, 137, 193
TfiI GAWTC 2 cut(s) 39, 238
TspDTI ATGAA 2 cut(s) 68, 212
XceI RCATGY 1 cut(s) 178
XmiI GTMKAC 1 cut(s) 14
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.