Rh3BG122000

gamma-irradiation and mitomycin c induced

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3B
Physical Location & Seq
Reverse (-)
10016158 .. 10017645
1488 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3BG122000.1

Sequence Viewer

Length: 279 bp
ATGTCCAACCTATTGTTATATGAGAAAAGTGTATCAATTTATGTCTACTCCAACAATGATGTTTTACTGAATCTTCAGTCTCAAACTGAGAAAAGGGTGTTGATGATTTCATCAAAGGTGCCTGACGTTTGCGTGGCTGGTACTCAAATGGAAAATATGGTTTTTGAAATTGTCATCCTTGATGTTGTTGATGATACTATTCAGCATGTTGATAAAAGTGGCCAATTACATATAGCTACAATAATGGGCGGTTCATCATCCATGGAGGAATCCCTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

92

Amino Acids

10.19

Weight (kDa)

4.41

Isoelectric Point (pI)

42.34

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 118
AccI GTMKAC 1 cut(s) 45
AciI CCGC 1 cut(s) 249
AcoI YGGCCR 1 cut(s) 220
AcuI CTGAAG 1 cut(s) 59
AfaI GTAC 1 cut(s) 142
AgsI TTSAA 1 cut(s) 167
AluBI AGCT 1 cut(s) 236
AluI AGCT 1 cut(s) 236
Alw26I GTCTC 1 cut(s) 84
AoxI GGCC 1 cut(s) 220
BalI TGGCCA 1 cut(s) 222
BanI GGYRCC 1 cut(s) 118
BcoDI GTCTC 1 cut(s) 84
BmiI GGNNCC 1 cut(s) 120
BsaJI CCNNGG 1 cut(s) 261
BseDI CCNNGG 1 cut(s) 261
BseGI GGATG 2 cut(s) 174, 257
BseMII CTCAG 1 cut(s) 78
BshFI GGCC 1 cut(s) 222
BshNI GGYRCC 1 cut(s) 118
BsmAI GTCTC 1 cut(s) 84
BsnI GGCC 1 cut(s) 222
Bsp19I CCATGG 1 cut(s) 261
BspACI CCGC 1 cut(s) 249
BspANI GGCC 1 cut(s) 222
BspCNI CTCAG 1 cut(s) 79
BspLI GGNNCC 1 cut(s) 120
BspT107I GGYRCC 1 cut(s) 118
BssECI CCNNGG 1 cut(s) 261
BssT1I CCWWGG 1 cut(s) 261
BstDEI CTNAG 1 cut(s) 87
BstDSI CCRYGG 1 cut(s) 261
BstF5I GGATG 2 cut(s) 174, 257
BstMAI GTCTC 1 cut(s) 84
BstNSI RCATGY 1 cut(s) 209
BsuRI GGCC 1 cut(s) 222
BtgI CCRYGG 1 cut(s) 261
BtsCI GGATG 2 cut(s) 174, 257
Csp6I GTAC 1 cut(s) 141
CviAII CATG 2 cut(s) 206, 262
CviJI RGCY 3 cut(s) 137, 222, 236
CviKI_1 RGCY 3 cut(s) 137, 222, 236
CviQI GTAC 1 cut(s) 141
DdeI CTNAG 1 cut(s) 87
EaeI YGGCCR 1 cut(s) 220
Eco130I CCWWGG 1 cut(s) 261
Eco57I CTGAAG 1 cut(s) 59
EcoT14I CCWWGG 1 cut(s) 261
ErhI CCWWGG 1 cut(s) 261
FaeI CATG 2 cut(s) 209, 265
FaiI YATR 8 cut(s) 19, 21, 42, 158, 207, 231, 233, 263
FatI CATG 2 cut(s) 205, 261
FblI GTMKAC 1 cut(s) 45
FokI GGATG 2 cut(s) 161, 244
HaeIII GGCC 1 cut(s) 222
Hin1II CATG 2 cut(s) 209, 265
HinfI GANTC 2 cut(s) 70, 269
Hpy166II GTNNAC 1 cut(s) 46
Hpy8I GTNNAC 1 cut(s) 46
HpyCH4IV ACGT 1 cut(s) 126
HpyF3I CTNAG 1 cut(s) 87
HpySE526I ACGT 1 cut(s) 126
Hsp92II CATG 2 cut(s) 209, 265
LpnPI CCDG 2 cut(s) 123, 135
MaeII ACGT 1 cut(s) 126
MboII GAAGA 1 cut(s) 65
MlsI TGGCCA 1 cut(s) 222
MluCI AATT 3 cut(s) 36, 168, 224
MluNI TGGCCA 1 cut(s) 222
MmeI TCCRAC 2 cut(s) 30, 75
MnlI CCTC 1 cut(s) 259
Mox20I TGGCCA 1 cut(s) 222
MscI TGGCCA 1 cut(s) 222
Msp20I TGGCCA 1 cut(s) 222
NcoI CCATGG 1 cut(s) 261
NlaIII CATG 2 cut(s) 209, 265
NlaIV GGNNCC 1 cut(s) 120
NspI RCATGY 1 cut(s) 209
PfeI GAWTC 2 cut(s) 70, 269
PspN4I GGNNCC 1 cut(s) 120
RsaI GTAC 1 cut(s) 142
RsaNI GTAC 1 cut(s) 141
SetI ASST 4 cut(s) 12, 120, 129, 238
SgeI CNNG 6 cut(s) 134, 145, 150, 191, 218, 274
Sse9I AATT 3 cut(s) 36, 168, 224
SsiI CCGC 1 cut(s) 249
StyI CCWWGG 1 cut(s) 261
TaiI ACGT 1 cut(s) 129
TasI AATT 3 cut(s) 36, 168, 224
TfiI GAWTC 2 cut(s) 70, 269
TspDTI ATGAA 2 cut(s) 99, 243
XceI RCATGY 1 cut(s) 209
XmiI GTMKAC 1 cut(s) 45
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.