Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8508477.1

Orthogroup ID

OG0001008

Physical Location & Seq

Genomic Coordinates Forward (+)

1811 .. 2437

Gene Structure 627 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8508477.1_g000002.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 543 bp

atgacaccaagctcaggtttcaatatttggccttctgcagagaaatacaagcctagcactcaagattggccgaaccatggaggagacttgtataacagaagatatgctaacacggagaagaagataagccctgcaacagtttccaatctcagtgtgaagtggaaattctccgtgggaggtgacataactgtaacaccaaccatttctgatggcattctctacttccctagctggaatggatatctctatgccgttaaagaatctgatggatcccttgtctggaagaagaatgtgcagaagttgacaggcttcaataacactggcttcattctcaatgtcaactccacagtgacaagatcaacgccaacaatcgccggtgaccttctcattgttggaatctatggtcctgcttttgtcattgctgtcaaaaggtccaatgggaagctcgtttggtcaaccagggttgacaaccacaccagagcctttgtcaccatgtctggaacatattacaatgggttagtcaacttttctgttatgttttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

PQQ PQQ_2 PQQ_3

Protein Analysis

180

Amino Acids

19.94

Weight (kDa)

9.7

Isoelectric Point (pI)

30.4

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001008)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_4g31710 FvH4_4g31710 FvH4_6g49090 FvH4_6g49090 FvH4_6g49090 FvH4_6g49090 FvH4_6g49090 FvH4_6g49110 FvH4_6g49111
malus_domestica	MD09G1048500.v1.1 MD09G1048700.v1.1 MD13G1077000.v1.1 MD17G1048600.v1.1
prunus_persica	Prupe.1G270000_v2.0.a1 Prupe.3G270300_v2.0.a1 Prupe.3G270400_v2.0.a1 Prupe.3G270500_v2.0.a1 Prupe.3G270600_v2.0.a1
pyrus_communis	pycom13g06710 pycom17g04320 pycom17g04340
rosa_chinensis	RchiOBHm_Chr2g0168951 RchiOBHm_Chr2g0168981 RchiOBHm_Chr2g0168991 RchiOBHm_Chr4g0440311
rosa_laevigata	RLG00000006193 RLG00000021816 RLG00000021819 RLG00000021820 RLG00000021821
rosa_multiflora	Rmu_co8508477.1_g000001 Rmu_co8508477.1_g000002 Rmu_co8508477.1_g000003 Rmu_sc0001685.1_g000040 Rmu_ssc0000393.1_g000016 Rmu_ssc0000393.1_g000019 Rmu_ssc0000393.1_g000020
rosa_roxburghii	Rroxscaffold_2G00082560 Rroxscaffold_2G00082570 Rroxscaffold_5G00381190
rosa_rugosa	Rorug02G0536200 Rorug02G0536300.1 Rorug02G0536400 Rorug02G0536400 Rorug04G0325500
rosa_samantha	Rh2AG607300 Rh2AG607500 Rh2BG620000 Rh2CG588600 Rh2CG588700 Rh2CG588900 Rh2CG589000 Rh2DG630700 Rh2DG630800 Rh4AG376400 Rh4BG389400 Rh4CG404200 Rh4DG383100
rosa_wichuraiana	Rw2G050350 Rw2G050360 Rw2G050370 Rw4G032220

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	2 cut(s)	264, 277
AcoI	YGGCCR	1 cut(s)	68
AcsI	RAATTY	1 cut(s)	164
AfiI	CCNNNNNNNGG	3 cut(s)	14, 77, 279
AgsI	TTSAA	2 cut(s)	22, 313
AjnI	CCWGG	1 cut(s)	458
AluBI	AGCT	3 cut(s)	12, 231, 445
AluI	AGCT	3 cut(s)	12, 231, 445
Alw26I	GTCTC	1 cut(s)	78
AlwI	GGATC	2 cut(s)	264, 277
AoxI	GGCC	2 cut(s)	29, 68
ApoI	RAATTY	1 cut(s)	164
AspS9I	GGNCC	2 cut(s)	404, 432
AsuHPI	GGTGA	3 cut(s)	191, 389, 481
AvaII	GGWCC	2 cut(s)	404, 432
BamHI	GGATCC	1 cut(s)	269
BccI	CCATC	2 cut(s)	203, 260
BceAI	ACGGC	1 cut(s)	236
BciT130I	CCWGG	1 cut(s)	460
BcoDI	GTCTC	1 cut(s)	78
BfaI	CTAG	2 cut(s)	54, 228
BfmI	CTRYAG	1 cut(s)	36
Bme1390I	CCNGG	1 cut(s)	460
Bme18I	GGWCC	2 cut(s)	404, 432
BmgT120I	GGNCC	2 cut(s)	404, 432
BmiI	GGNNCC	1 cut(s)	271
BmrFI	CCNGG	1 cut(s)	460
Bpu10I	CCTNAGC	1 cut(s)	13
BpuEI	CTTGAG	1 cut(s)	45
BsaJI	CCNNGG	3 cut(s)	76, 171, 459
Bsc4I	CCNNNNNNNGG	3 cut(s)	14, 77, 279
Bse118I	RCCGGY	1 cut(s)	374
Bse1I	ACTGG	1 cut(s)	325
Bse3DI	GCAATG	1 cut(s)	417
BseBI	CCWGG	1 cut(s)	460
BseDI	CCNNGG	3 cut(s)	76, 171, 459
BseLI	CCNNNNNNNGG	3 cut(s)	14, 77, 279
BseMI	GCAATG	1 cut(s)	417
BseMII	CTCAG	2 cut(s)	27, 163
BseNI	ACTGG	1 cut(s)	325
BseRI	GAGGAG	1 cut(s)	96
BsgI	GTGCAG	1 cut(s)	314
BshFI	GGCC	2 cut(s)	31, 70
BsiSI	CCGG	1 cut(s)	375
BslI	CCNNNNNNNGG	3 cut(s)	14, 77, 279
BsmAI	GTCTC	1 cut(s)	78
BsmI	GAATGC	1 cut(s)	213
BsnI	GGCC	2 cut(s)	31, 70
Bsp143I	GATC	2 cut(s)	269, 356
Bsp19I	CCATGG	1 cut(s)	76
BspANI	GGCC	2 cut(s)	31, 70
BspCNI	CTCAG	2 cut(s)	26, 162
BspLI	GGNNCC	1 cut(s)	271
BspMAI	CTGCAG	1 cut(s)	40
BspPI	GGATC	2 cut(s)	264, 277
BsrDI	GCAATG	1 cut(s)	417
BsrFI	RCCGGY	1 cut(s)	374
BsrI	ACTGG	1 cut(s)	325
BssAI	RCCGGY	1 cut(s)	374
BssECI	CCNNGG	3 cut(s)	76, 171, 459
BssMI	GATC	2 cut(s)	269, 356
BssT1I	CCWWGG	1 cut(s)	76
Bst2UI	CCWGG	1 cut(s)	460
Bst4CI	ACNGT	3 cut(s)	139, 190, 349
BstDEI	CTNAG	2 cut(s)	13, 149
BstDSI	CCRYGG	2 cut(s)	76, 171
BstEII	GGTNACC	1 cut(s)	377
BstKTI	GATC	2 cut(s)	272, 359
BstMAI	GTCTC	1 cut(s)	78
BstMBI	GATC	2 cut(s)	269, 356
BstNI	CCWGG	1 cut(s)	460
BstPI	GGTNACC	1 cut(s)	377
BstSCI	CCNGG	1 cut(s)	458
BstSFI	CTRYAG	1 cut(s)	36
BstX2I	RGATCY	1 cut(s)	269
BstYI	RGATCY	1 cut(s)	269
BsuRI	GGCC	2 cut(s)	31, 70
BtgI	CCRYGG	2 cut(s)	76, 171
BtsIMutI	CAGTG	3 cut(s)	157, 318, 354
Cfr10I	RCCGGY	1 cut(s)	374
Cfr13I	GGNCC	2 cut(s)	404, 432
CviAII	CATG	2 cut(s)	77, 493
DdeI	CTNAG	2 cut(s)	13, 149
DpnI	GATC	2 cut(s)	271, 358
DpnII	GATC	2 cut(s)	269, 356
EaeI	YGGCCR	1 cut(s)	68
Eco130I	CCWWGG	1 cut(s)	76
Eco32I	GATATC	1 cut(s)	242
Eco47I	GGWCC	2 cut(s)	404, 432
Eco91I	GGTNACC	1 cut(s)	377
EcoO65I	GGTNACC	1 cut(s)	377
EcoRII	CCWGG	1 cut(s)	458
EcoRV	GATATC	1 cut(s)	242
EcoT14I	CCWWGG	1 cut(s)	76
ErhI	CCWWGG	1 cut(s)	76
FaeI	CATG	2 cut(s)	80, 496
FaiI	YATR	9 cut(s)	78, 93, 105, 185, 249, 402, 494, 505, 536
FatI	CATG	2 cut(s)	76, 492
FspBI	CTAG	2 cut(s)	54, 228
HaeIII	GGCC	2 cut(s)	31, 70
HapII	CCGG	1 cut(s)	375
Hin1II	CATG	2 cut(s)	80, 496
HincII	GTYRAC	5 cut(s)	303, 340, 456, 466, 523
HindII	GTYRAC	5 cut(s)	303, 340, 456, 466, 523
HinfI	GANTC	2 cut(s)	260, 396
HpaII	CCGG	1 cut(s)	375
HphI	GGTGA	3 cut(s)	191, 389, 481
Hpy166II	GTNNAC	5 cut(s)	303, 340, 456, 466, 523
Hpy188I	TCNGA	2 cut(s)	208, 265
Hpy188III	TCNNGA	3 cut(s)	62, 280, 498
Hpy8I	GTNNAC	5 cut(s)	303, 340, 456, 466, 523
HpyAV	CCTTC	2 cut(s)	42, 392
HpyCH4III	ACNGT	3 cut(s)	139, 190, 349
HpyCH4V	TGCA	3 cut(s)	38, 134, 295
HpyF3I	CTNAG	2 cut(s)	13, 149
Hsp92II	CATG	2 cut(s)	80, 496
Kzo9I	GATC	2 cut(s)	269, 356
MaeI	CTAG	2 cut(s)	54, 228
MaeIII	GTNAC	5 cut(s)	179, 190, 349, 377, 487
MalI	GATC	2 cut(s)	271, 358
MboI	GATC	2 cut(s)	269, 356
MboII	GAAGA	5 cut(s)	111, 130, 133, 295, 298
MflI	RGATCY	1 cut(s)	269
MluCI	AATT	1 cut(s)	164
MmeI	TCCRAC	1 cut(s)	373
MnlI	CCTC	2 cut(s)	74, 170
MseI	TTAA	2 cut(s)	255, 541
MspI	CCGG	1 cut(s)	375
MspR9I	CCNGG	1 cut(s)	460
Mva1269I	GAATGC	1 cut(s)	213
MvaI	CCWGG	1 cut(s)	460
NcoI	CCATGG	1 cut(s)	76
NdeII	GATC	2 cut(s)	269, 356
NlaIII	CATG	2 cut(s)	80, 496
NlaIV	GGNNCC	1 cut(s)	271
NmuCI	GTSAC	4 cut(s)	179, 349, 377, 487
PctI	GAATGC	1 cut(s)	213
PfeI	GAWTC	2 cut(s)	260, 396
Psp6I	CCWGG	1 cut(s)	458
PspEI	GGTNACC	1 cut(s)	377
PspGI	CCWGG	1 cut(s)	458
PspN4I	GGNNCC	1 cut(s)	271
PspPI	GGNCC	2 cut(s)	404, 432
PstI	CTGCAG	1 cut(s)	40
PsuI	RGATCY	1 cut(s)	269
SaqAI	TTAA	2 cut(s)	255, 541
Sau3AI	GATC	2 cut(s)	269, 356
Sau96I	GGNCC	2 cut(s)	404, 432
ScrFI	CCNGG	1 cut(s)	460
SetI	ASST	7 cut(s)	14, 19, 181, 233, 384, 434, 447
SfcI	CTRYAG	1 cut(s)	36
SgrAI	CRCCGGYG	1 cut(s)	374
SinI	GGWCC	2 cut(s)	404, 432
SmlI	CTYRAG	1 cut(s)	60
SmoI	CTYRAG	1 cut(s)	60
Sse9I	AATT	1 cut(s)	164
SspI	AATATT	1 cut(s)	25
SspMI	CTAG	2 cut(s)	54, 228
StyD4I	CCNGG	1 cut(s)	458
StyI	CCWWGG	1 cut(s)	76
TaaI	ACNGT	3 cut(s)	139, 190, 349
TasI	AATT	1 cut(s)	164
TfiI	GAWTC	2 cut(s)	260, 396
Tru1I	TTAA	2 cut(s)	255, 541
Tru9I	TTAA	2 cut(s)	255, 541
TscAI	CASTG	3 cut(s)	157, 325, 354
TseFI	GTSAC	4 cut(s)	179, 349, 377, 487
Tsp45I	GTSAC	4 cut(s)	179, 349, 377, 487
TspDTI	ATGAA	1 cut(s)	316
TspGWI	ACGGA	2 cut(s)	128, 160
TspRI	CASTG	3 cut(s)	157, 325, 354
VpaK11BI	GGWCC	2 cut(s)	404, 432
XapI	RAATTY	1 cut(s)	164
XspI	CTAG	2 cut(s)	54, 228

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.