Rmu_sc0000206.1_g000022

Pathogen-related protein-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000206.1
Physical Location & Seq
Forward (+)
137860 .. 138925
1066 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000206.1_g000022.1.cds

Sequence Viewer

Length: 720 bp
atggcatctgaaggtggtgttgagggagatagatatcgttactatttgcatggagaaggagagaggagcaccaaatggaagtttggtacacctcccaactatgaggttgttaacaagcttttcgaagaaggcagaaccaagatatggccagctgggtcactagaagacaaggtgcagaacctagtaaagacatgggaaatggaacttttccacaaagctaacattgaggatttcaagacacttgatcccaacaagtacactttcagcctaaatgggagaaaagggataaatttggaagaaataggaaaactaggaggaggatacaacccgttgcttcagaccacactgcctcagaatctgaggggctataatcctgatgtggaaacatctgaatcatcacataaggctttcacaacaacattcccaagaggatttgcgttggagattcttcaagtcatttctgggccgccgcagatcgtgtacaaattcaggcactggggttacatggagggccctttcaaaggccacgccccaactggagaacttgtcgaggtctatggaatggccatttttgagttggacgagaatgaaaaaatcgtgaaggtggagttcttttatgacccaggacagctacttggtggacttttgaagggtgcaaaagtgggttcttcttctgaggagactgctacaggctgccctatcctaaggagtactgggtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

239

Amino Acids

26.78

Weight (kDa)

5.65

Isoelectric Point (pI)

38.79

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000669)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G78780 AT1G78780 AT1G78780 AT1G78780 AT1G78780
fragaria_vesca FvH4_2g14470 FvH4_2g14570 FvH4_2g14570 FvH4_7g16730
malus_domestica MD05G1017100.v1.1 MD05G1017400.v1.1 MD10G1016800.v1.1 MD10G1017300.v1.1
prunus_persica Prupe.8G020800_v2.0.a1 Prupe.8G020900_v2.0.a1 Prupe.8G020900_v2.0.a1 Prupe.8G021200_v2.0.a1 Prupe.8G021300_v2.0.a1
pyrus_communis pycom05g00960 pycom05g00970 pycom10g01100
rosa_chinensis RchiOBHm_Chr6g0276801 RchiOBHm_Chr6g0276811 RchiOBHm_Chr6g0276851 RchiOBHm_Chr6g0276861 RchiOBHm_Chr6g0276871 RchiOBHm_Chr6g0276881 RchiOBHm_Chr6g0276891 RchiOBHm_Chr6g0276971
rosa_laevigata RLG00000013345 RLG00000013357 RLG00000013358 RLG00000013360
rosa_multiflora Rmu_co8320001.1_g000001 Rmu_sc0000190.1_g000015 Rmu_sc0000190.1_g000017 Rmu_sc0000190.1_g000022 Rmu_sc0000206.1_g000022 Rmu_sc0001425.1_g000028 Rmu_sc0003882.1_g000007 Rmu_sc0003882.1_g000028 Rmu_sc0004481.1_g000001 Rmu_sc0004481.1_g000009
rosa_roxburghii Rroxscaffold_7G00191780 Rroxscaffold_7G00191840 Rroxscaffold_7G00191870 Rroxscaffold_7G00191880 Rroxscaffold_7G00191890 Rroxscaffold_7G00191930
rosa_rugosa Rorug06G0104600 Rorug06G0104700 Rorug06G0105000 Rorug06G0105100.1 Rorug06G0105200
rosa_samantha Rh6AG214500 Rh6AG214600 Rh6AG214700 Rh6AG215500 Rh6BG219300 Rh6BG219400 Rh6BG219500 Rh6BG219600 Rh6BG220100 Rh6CG222000 Rh6CG222100 Rh6CG222500 Rh6DG212000 Rh6DG212100 Rh6DG212200 Rh6DG212300 Rh6DG212400 Rh6DG212700
rosa_wichuraiana Rw6G018760 Rw6G018770 Rw6G018780 Rw6G018820

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 144
AciI CCGC 2 cut(s) 467, 470
AclWI GGATC 1 cut(s) 239
AcoI YGGCCR 2 cut(s) 146, 564
AcsI RAATTY 2 cut(s) 289, 485
AcuI CTGAAG 2 cut(s) 30, 320
AfaI GTAC 4 cut(s) 88, 257, 482, 712
AfiI CCNNNNNNNGG 2 cut(s) 144, 521
AgsI TTSAA 4 cut(s) 235, 452, 520, 649
AjnI CCWGG 1 cut(s) 622
AluBI AGCT 4 cut(s) 118, 152, 218, 631
AluI AGCT 4 cut(s) 118, 152, 218, 631
Alw21I GWGCWC 1 cut(s) 71
Alw26I GTCTC 1 cut(s) 674
AlwI GGATC 1 cut(s) 239
AlwNI CAGNNNCTG 2 cut(s) 358, 495
AoxI GGCC 5 cut(s) 146, 464, 511, 523, 564
ApaI GGGCCC 1 cut(s) 515
ApeKI GCWGC 1 cut(s) 693
ApoI RAATTY 2 cut(s) 289, 485
AspS9I GGNCC 3 cut(s) 464, 511, 512
AsuII TTCGAA 1 cut(s) 123
AxyI CCTNAGG 1 cut(s) 704
BaeGI GKGCMC 1 cut(s) 515
BalI TGGCCA 2 cut(s) 148, 566
BanII GRGCYC 1 cut(s) 515
BbsI GAAGAC 1 cut(s) 171
Bbv12I GWGCWC 1 cut(s) 71
BbvI GCAGC 1 cut(s) 680
BciT130I CCWGG 1 cut(s) 624
BciVI GTATCC 1 cut(s) 314
BcoDI GTCTC 1 cut(s) 674
BfaI CTAG 3 cut(s) 161, 182, 311
BfmI CTRYAG 1 cut(s) 687
BfuI GTATCC 1 cut(s) 314
BisI GCNGC 3 cut(s) 467, 470, 694
BlsI GCNGC 3 cut(s) 468, 471, 695
BmcAI AGTACT 1 cut(s) 712
Bme1390I CCNGG 1 cut(s) 624
BmgT120I GGNCC 3 cut(s) 464, 511, 512
BmiI GGNNCC 1 cut(s) 513
BmrFI CCNGG 1 cut(s) 624
BmrI ACTGGG 1 cut(s) 505
BmsI GCATC 1 cut(s) 14
BmuI ACTGGG 1 cut(s) 505
BpiI GAAGAC 1 cut(s) 171
BpmI CTGGAG 1 cut(s) 558
Bpu14I TTCGAA 1 cut(s) 123
BsaBI GATNNNNATC 1 cut(s) 33
BsaJI CCNNGG 1 cut(s) 622
BsaXI ACNNNNNCTCC 2 cut(s) 531, 561
Bsc4I CCNNNNNNNGG 2 cut(s) 144, 521
Bse1I ACTGG 3 cut(s) 500, 541, 718
Bse21I CCTNAGG 1 cut(s) 704
Bse8I GATNNNNATC 1 cut(s) 33
BseBI CCWGG 1 cut(s) 624
BseDI CCNNGG 1 cut(s) 622
BseJI GATNNNNATC 1 cut(s) 33
BseLI CCNNNNNNNGG 2 cut(s) 144, 521
BseMII CTCAG 3 cut(s) 350, 365, 666
BseNI ACTGG 3 cut(s) 500, 541, 718
BseRI GAGGAG 3 cut(s) 79, 330, 692
BseSI GKGCMC 1 cut(s) 515
BseXI GCAGC 1 cut(s) 680
BseYI CCCAGC 1 cut(s) 152
BsgI GTGCAG 1 cut(s) 194
BshFI GGCC 5 cut(s) 148, 466, 513, 525, 566
BsiHKAI GWGCWC 1 cut(s) 71
BslI CCNNNNNNNGG 2 cut(s) 144, 521
BsmAI GTCTC 1 cut(s) 674
BsnI GGCC 5 cut(s) 148, 466, 513, 525, 566
Bsp119I TTCGAA 1 cut(s) 123
Bsp120I GGGCCC 1 cut(s) 511
Bsp1286I GDGCHC 2 cut(s) 71, 515
Bsp1407I TGTACA 1 cut(s) 480
Bsp143I GATC 2 cut(s) 244, 474
BspACI CCGC 2 cut(s) 467, 470
BspANI GGCC 5 cut(s) 148, 466, 513, 525, 566
BspCNI CTCAG 3 cut(s) 351, 364, 667
BspLI GGNNCC 1 cut(s) 513
BspPI GGATC 1 cut(s) 239
BspT104I TTCGAA 1 cut(s) 123
BsrGI TGTACA 1 cut(s) 480
BsrI ACTGG 3 cut(s) 500, 541, 718
BssECI CCNNGG 1 cut(s) 622
BssMI GATC 2 cut(s) 244, 474
Bst2UI CCWGG 1 cut(s) 624
BstAUI TGTACA 1 cut(s) 480
BstBI TTCGAA 1 cut(s) 123
BstC8I GCNNGC 1 cut(s) 150
BstDEI CTNAG 4 cut(s) 351, 359, 675, 704
BstENI CCTNNNNNAGG 1 cut(s) 519
BstKTI GATC 2 cut(s) 247, 477
BstMAI GTCTC 1 cut(s) 674
BstMBI GATC 2 cut(s) 244, 474
BstNI CCWGG 1 cut(s) 624
BstSCI CCNGG 1 cut(s) 622
BstSFI CTRYAG 1 cut(s) 687
BstSLI GKGCMC 1 cut(s) 515
BstV1I GCAGC 1 cut(s) 680
BstV2I GAAGAC 1 cut(s) 171
Bsu36I CCTNAGG 1 cut(s) 704
BsuI GTATCC 1 cut(s) 314
BsuRI GGCC 5 cut(s) 148, 466, 513, 525, 566
BtsI GCAGTG 1 cut(s) 344
BtsIMutI CAGTG 2 cut(s) 344, 493
Cac8I GCNNGC 1 cut(s) 150
CaiI CAGNNNCTG 2 cut(s) 358, 495
Cfr13I GGNCC 3 cut(s) 464, 511, 512
Csp6I GTAC 4 cut(s) 87, 256, 481, 711
CviAII CATG 3 cut(s) 50, 192, 505
CviQI GTAC 4 cut(s) 87, 256, 481, 711
DdeI CTNAG 4 cut(s) 351, 359, 675, 704
DpnI GATC 2 cut(s) 246, 476
DpnII GATC 2 cut(s) 244, 474
EaeI YGGCCR 2 cut(s) 146, 564
Eco24I GRGCYC 1 cut(s) 515
Eco32I GATATC 1 cut(s) 35
Eco57I CTGAAG 2 cut(s) 30, 320
Eco81I CCTNAGG 1 cut(s) 704
EcoNI CCTNNNNNAGG 1 cut(s) 519
EcoO109I RGGNCCY 2 cut(s) 511, 512
EcoRII CCWGG 1 cut(s) 622
EcoRV GATATC 1 cut(s) 35
EcoT38I GRGCYC 1 cut(s) 515
FaeI CATG 3 cut(s) 53, 195, 508
FaiI YATR 9 cut(s) 51, 102, 145, 193, 369, 402, 506, 558, 618
FatI CATG 3 cut(s) 49, 191, 504
Fnu4HI GCNGC 3 cut(s) 467, 470, 694
FriOI GRGCYC 1 cut(s) 515
Fsp4HI GCNGC 3 cut(s) 467, 470, 694
FspBI CTAG 3 cut(s) 161, 182, 311
GluI GCNGC 3 cut(s) 467, 470, 694
GsaI CCCAGC 1 cut(s) 156
GsuI CTGGAG 1 cut(s) 558
HaeIII GGCC 5 cut(s) 148, 466, 513, 525, 566
Hin1II CATG 3 cut(s) 53, 195, 508
HincII GTYRAC 1 cut(s) 112
HindII GTYRAC 1 cut(s) 112
HindIII AAGCTT 1 cut(s) 116
HinfI GANTC 3 cut(s) 355, 392, 445
HpaI GTTAAC 1 cut(s) 112
Hpy166II GTNNAC 5 cut(s) 89, 112, 258, 481, 641
Hpy188I TCNGA 6 cut(s) 10, 339, 354, 360, 391, 676
Hpy188III TCNNGA 3 cut(s) 235, 374, 598
Hpy8I GTNNAC 5 cut(s) 89, 112, 258, 481, 641
HpyAV CCTTC 5 cut(s) 5, 50, 122, 595, 643
HpyCH4V TGCA 3 cut(s) 49, 175, 656
HpyF3I CTNAG 4 cut(s) 351, 359, 675, 704
Hsp92II CATG 3 cut(s) 53, 195, 508
KspAI GTTAAC 1 cut(s) 112
Kzo9I GATC 2 cut(s) 244, 474
LmnI GCTCC 1 cut(s) 66
Lsp1109I GCAGC 1 cut(s) 680
LweI GCATC 1 cut(s) 14
MaeI CTAG 3 cut(s) 161, 182, 311
MaeIII GTNAC 3 cut(s) 38, 156, 500
MalI GATC 2 cut(s) 246, 476
MboI GATC 2 cut(s) 244, 474
MboII GAAGA 6 cut(s) 137, 176, 308, 440, 660, 663
MhlI GDGCHC 2 cut(s) 71, 515
MlsI TGGCCA 2 cut(s) 148, 566
MluCI AATT 2 cut(s) 289, 485
MluNI TGGCCA 2 cut(s) 148, 566
MmeI TCCRAC 2 cut(s) 420, 558
Mox20I TGGCCA 2 cut(s) 148, 566
MscI TGGCCA 2 cut(s) 148, 566
MseI TTAA 1 cut(s) 111
Msp20I TGGCCA 2 cut(s) 148, 566
MspA1I CMGCKG 1 cut(s) 152
MspR9I CCNGG 1 cut(s) 624
MvaI CCWGG 1 cut(s) 624
NdeII GATC 2 cut(s) 244, 474
NlaIII CATG 3 cut(s) 53, 195, 508
NlaIV GGNNCC 1 cut(s) 513
NmuCI GTSAC 1 cut(s) 156
NspV TTCGAA 1 cut(s) 123
PfeI GAWTC 3 cut(s) 355, 392, 445
PflMI CCANNNNNTGG 1 cut(s) 144
PkrI GCNGC 3 cut(s) 468, 471, 695
Psp6I CCWGG 1 cut(s) 622
PspFI CCCAGC 1 cut(s) 152
PspGI CCWGG 1 cut(s) 622
PspN4I GGNNCC 1 cut(s) 513
PspOMI GGGCCC 1 cut(s) 511
PspPI GGNCC 3 cut(s) 464, 511, 512
PstNI CAGNNNCTG 2 cut(s) 358, 495
PvuII CAGCTG 1 cut(s) 152
RsaI GTAC 4 cut(s) 88, 257, 482, 712
RsaNI GTAC 4 cut(s) 87, 256, 481, 711
SaqAI TTAA 1 cut(s) 111
SatI GCNGC 3 cut(s) 467, 470, 694
Sau3AI GATC 2 cut(s) 244, 474
Sau96I GGNCC 3 cut(s) 464, 511, 512
ScaI AGTACT 1 cut(s) 712
ScrFI CCNGG 1 cut(s) 624
SduI GDGCHC 2 cut(s) 71, 515
SfaNI GCATC 1 cut(s) 14
SfcI CTRYAG 1 cut(s) 687
SfuI TTCGAA 1 cut(s) 123
Sse9I AATT 2 cut(s) 289, 485
SsiI CCGC 2 cut(s) 467, 470
SspMI CTAG 3 cut(s) 161, 182, 311
StyD4I CCNGG 1 cut(s) 622
TaqI TCGA 2 cut(s) 123, 549
TasI AATT 2 cut(s) 289, 485
TatI WGTACW 3 cut(s) 255, 480, 710
TauI GCSGC 2 cut(s) 469, 472
TfiI GAWTC 3 cut(s) 355, 392, 445
Tru1I TTAA 1 cut(s) 111
Tru9I TTAA 1 cut(s) 111
TscAI CASTG 2 cut(s) 351, 500
TseFI GTSAC 1 cut(s) 156
TseI GCWGC 1 cut(s) 693
Tsp45I GTSAC 1 cut(s) 156
TspDTI ATGAA 1 cut(s) 603
TspRI CASTG 2 cut(s) 351, 500
Van91I CCANNNNNTGG 1 cut(s) 144
XagI CCTNNNNNAGG 1 cut(s) 519
XapI RAATTY 2 cut(s) 289, 485
XcmI CCANNNNNNNNNTGG 2 cut(s) 533, 574
XspI CTAG 3 cut(s) 161, 182, 311
ZrmI AGTACT 1 cut(s) 712
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.