Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001372.1

Orthogroup ID

OG0002306

Physical Location & Seq

Genomic Coordinates Forward (+)

31965 .. 33005

Gene Structure 1041 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001372.1_g000005.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 699 bp

atgatgtttgccatcggaacattgatggttgatacagtggcaactgggtactacaaaaggtcaagcttgaagtcaacccaggtgacaatggatgtagagagcatagctggtcatgatcatggtcatgcaggtcatgtacatcatactgttcatacacatggtgccacacagggtagtaatgctcatggctctgaagaattgagatcatcatcagaattaatcaggcatagggtcatttcacaagtgttggagctggggattctagtccattcagttataattggaataacattgggtgcatcccaaaagccagatacaataaagcctctcctggtggctttgtctttccatcaattctttgagggcatcggacttggtggctgcatctctcaggcgaagtttaaggctcggtctgcagtcataatggcggcatttttttcccttacaacccccattgggattgcagttggtaccggaatttcaagcgtttacagtgagactagcccaactgctctaattgttcaagggactttggattcagctgcagctgggattttaatttacatggctcttgttgacctacttgcagcagatttcatgagccctagaatgcaaggaaatatgaggattcaattggggtcatatatctcacttcttctagggactggctgtatgtctctcttggcaaaatgggcttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000041 GO:0003674 GO:0005215 GO:0005385 GO:0005575 GO:0005623 GO:0005886 GO:0006810 GO:0006811 GO:0006812 GO:0006829 GO:0008150 GO:0008324 GO:0015075 GO:0015318 GO:0016020 GO:0022857 GO:0022890 GO:0030001 GO:0034220 GO:0044464 GO:0046873 GO:0046915 GO:0051179 GO:0051234 GO:0055085 GO:0070838 GO:0071577 GO:0071944 GO:0072509 GO:0072511 GO:0098655 GO:0098660 GO:0098662

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Zip

Protein Analysis

232

Amino Acids

24.51

Weight (kDa)

7.22

Isoelectric Point (pI)

25.72

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002306)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G12750
fragaria_vesca	FvH4_3g12900 FvH4_3g14490 FvH4_3g14490
malus_domestica	MD05G1236500.v1.1 MD05G1236600.v1.1 MD05G1247200.v1.1 MD10G1227800.v1.1
prunus_persica	Prupe.4G117200_v2.0.a1 Prupe.4G129600_v2.0.a1 Prupe.4G129700_v2.0.a1
pyrus_communis	pycom05g21350 pycom05g22310 pycom10g19130
rosa_chinensis	RchiOBHm_Chr5g0021001 RchiOBHm_Chr5g0023861 RchiOBHm_Chr5g0023871
rosa_laevigata	RLG00000032576 RLG00000032741 RLG00000032742
rosa_multiflora	Rmu_sc0001372.1_g000002 Rmu_sc0001372.1_g000005 Rmu_ssc0000027.1_g000003 Rmu_ssc0000244.1_g000011
rosa_roxburghii	Rroxscaffold_1G00055380 Rroxscaffold_1G00057480
rosa_rugosa	Rorug05G0063700 Rorug05G0079800 Rorug05G0079900
rosa_samantha	Rh5AG153300 Rh5AG169900 Rh5AG170000 Rh5BG153000 Rh5BG167200 Rh5BG167300 Rh5CG165600 Rh5CG182800 Rh5DG152400 Rh5DG169300
rosa_wichuraiana	Rw5G013620 Rw5G015360 Rw5G015370

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	278
Acc36I	ACCTGC	1 cut(s)	119
Acc65I	GGTACC	1 cut(s)	470
AccB1I	GGYRCC	2 cut(s)	161, 470
AciI	CCGC	1 cut(s)	428
AcsI	RAATTY	1 cut(s)	477
AcuI	CTGAAG	1 cut(s)	213
AdeI	CACNNNGTG	1 cut(s)	161
AfaI	GTAC	3 cut(s)	50, 138, 472
AfiI	CCNNNNNNNGG	1 cut(s)	456
AgsI	TTSAA	4 cut(s)	70, 483, 524, 632
AjnI	CCWGG	2 cut(s)	78, 330
AluBI	AGCT	5 cut(s)	66, 107, 253, 542, 548
AluI	AGCT	5 cut(s)	66, 107, 253, 542, 548
Alw26I	GTCTC	2 cut(s)	491, 681
ApeKI	GCWGC	4 cut(s)	381, 542, 545, 587
ApoI	RAATTY	1 cut(s)	477
AseI	ATTAAT	1 cut(s)	218
Asp718I	GGTACC	1 cut(s)	470
AsuHPI	GGTGA	1 cut(s)	94
BanI	GGYRCC	2 cut(s)	161, 470
BanII	GRGCYC	1 cut(s)	605
BbvI	GCAGC	4 cut(s)	368, 529, 557, 599
BccI	CCATC	3 cut(s)	19, 20, 357
BciT130I	CCWGG	2 cut(s)	80, 332
BclI	TGATCA	1 cut(s)	115
BcoDI	GTCTC	2 cut(s)	491, 681
BfaI	CTAG	4 cut(s)	263, 501, 606, 659
BfmI	CTRYAG	2 cut(s)	414, 543
BfuAI	ACCTGC	1 cut(s)	119
BisI	GCNGC	5 cut(s)	382, 429, 543, 546, 588
BlsI	GCNGC	5 cut(s)	383, 430, 544, 547, 589
Bme1390I	CCNGG	2 cut(s)	80, 332
BmiI	GGNNCC	2 cut(s)	163, 472
BmrFI	CCNGG	2 cut(s)	80, 332
BmrI	ACTGGG	1 cut(s)	54
BmsI	GCATC	3 cut(s)	308, 375, 393
BmuI	ACTGGG	1 cut(s)	54
BsaBI	GATNNNNATC	1 cut(s)	208
BsaJI	CCNNGG	1 cut(s)	78
BsaWI	WCCGGW	1 cut(s)	473
Bsc4I	CCNNNNNNNGG	1 cut(s)	456
Bse1I	ACTGG	2 cut(s)	49, 670
Bse8I	GATNNNNATC	1 cut(s)	208
BseBI	CCWGG	2 cut(s)	80, 332
BseDI	CCNNGG	1 cut(s)	78
BseGI	GGATG	2 cut(s)	97, 299
BseJI	GATNNNNATC	1 cut(s)	208
BseLI	CCNNNNNNNGG	1 cut(s)	456
BseMII	CTCAG	1 cut(s)	404
BseNI	ACTGG	2 cut(s)	49, 670
BseXI	GCAGC	4 cut(s)	368, 529, 557, 599
BseYI	CCCAGC	2 cut(s)	253, 548
BshNI	GGYRCC	2 cut(s)	161, 470
BsiSI	CCGG	1 cut(s)	474
BslFI	GGGAC	2 cut(s)	541, 676
BslI	CCNNNNNNNGG	1 cut(s)	456
BsmAI	GTCTC	2 cut(s)	491, 681
BsmFI	GGGAC	2 cut(s)	541, 676
BsmI	GAATGC	1 cut(s)	615
Bsp1286I	GDGCHC	1 cut(s)	605
Bsp1407I	TGTACA	1 cut(s)	136
Bsp143I	GATC	2 cut(s)	115, 203
BspACI	CCGC	1 cut(s)	428
BspCNI	CTCAG	1 cut(s)	403
BspHI	TCATGA	2 cut(s)	112, 597
BspLI	GGNNCC	2 cut(s)	163, 472
BspMAI	CTGCAG	2 cut(s)	418, 547
BspMI	ACCTGC	1 cut(s)	119
BspT107I	GGYRCC	2 cut(s)	161, 470
BsrGI	TGTACA	1 cut(s)	136
BsrI	ACTGG	2 cut(s)	49, 670
BssECI	CCNNGG	1 cut(s)	78
BssMI	GATC	2 cut(s)	115, 203
Bst2UI	CCWGG	2 cut(s)	80, 332
Bst4CI	ACNGT	3 cut(s)	37, 148, 494
BstAUI	TGTACA	1 cut(s)	136
BstDEI	CTNAG	1 cut(s)	390
BstF5I	GGATG	2 cut(s)	97, 299
BstKTI	GATC	2 cut(s)	118, 206
BstMAI	GTCTC	2 cut(s)	491, 681
BstMBI	GATC	2 cut(s)	115, 203
BstMWI	GCNNNNNNNGC	2 cut(s)	413, 692
BstNI	CCWGG	2 cut(s)	80, 332
BstSCI	CCNGG	2 cut(s)	78, 330
BstSFI	CTRYAG	2 cut(s)	414, 543
BstV1I	GCAGC	4 cut(s)	368, 529, 557, 599
BtsCI	GGATG	2 cut(s)	97, 299
BtsIMutI	CAGTG	2 cut(s)	42, 499
BveI	ACCTGC	1 cut(s)	119
CciI	TCATGA	2 cut(s)	112, 597
Csp6I	GTAC	3 cut(s)	49, 137, 471
CviAII	CATG	8 cut(s)	113, 119, 125, 134, 158, 185, 565, 598
CviQI	GTAC	3 cut(s)	49, 137, 471
DdeI	CTNAG	1 cut(s)	390
DpnI	GATC	2 cut(s)	117, 205
DpnII	GATC	2 cut(s)	115, 203
DraIII	CACNNNGTG	1 cut(s)	161
Eco24I	GRGCYC	1 cut(s)	605
Eco57I	CTGAAG	1 cut(s)	213
EcoRII	CCWGG	2 cut(s)	78, 330
EcoT38I	GRGCYC	1 cut(s)	605
FaeI	CATG	8 cut(s)	116, 122, 128, 137, 161, 188, 568, 601
FaqI	GGGAC	2 cut(s)	541, 676
FatI	CATG	8 cut(s)	112, 118, 124, 133, 157, 184, 564, 597
FbaI	TGATCA	1 cut(s)	115
Fnu4HI	GCNGC	5 cut(s)	382, 429, 543, 546, 588
FokI	GGATG	2 cut(s)	104, 286
FriOI	GRGCYC	1 cut(s)	605
Fsp4HI	GCNGC	5 cut(s)	382, 429, 543, 546, 588
FspBI	CTAG	4 cut(s)	263, 501, 606, 659
GluI	GCNGC	5 cut(s)	382, 429, 543, 546, 588
GsaI	CCCAGC	2 cut(s)	257, 552
HapII	CCGG	1 cut(s)	474
Hin1II	CATG	8 cut(s)	116, 122, 128, 137, 161, 188, 568, 601
HincII	GTYRAC	2 cut(s)	75, 577
HindII	GTYRAC	2 cut(s)	75, 577
HindIII	AAGCTT	1 cut(s)	64
HinfI	GANTC	3 cut(s)	259, 536, 628
HpaII	CCGG	1 cut(s)	474
HphI	GGTGA	1 cut(s)	94
Hpy166II	GTNNAC	3 cut(s)	75, 490, 577
Hpy188I	TCNGA	4 cut(s)	17, 193, 214, 371
Hpy188III	TCNNGA	2 cut(s)	113, 598
Hpy8I	GTNNAC	3 cut(s)	75, 490, 577
HpyCH4III	ACNGT	3 cut(s)	37, 148, 494
HpyCH4V	TGCA	8 cut(s)	128, 299, 384, 416, 464, 545, 587, 613
HpyF10VI	GCNNNNNNNGC	2 cut(s)	413, 692
HpyF3I	CTNAG	1 cut(s)	390
Hsp92II	CATG	8 cut(s)	116, 122, 128, 137, 161, 188, 568, 601
KpnI	GGTACC	1 cut(s)	474
Ksp22I	TGATCA	1 cut(s)	115
Kzo9I	GATC	2 cut(s)	115, 203
LmnI	GCTCC	1 cut(s)	250
Lsp1109I	GCAGC	4 cut(s)	368, 529, 557, 599
LweI	GCATC	3 cut(s)	308, 375, 393
MaeI	CTAG	4 cut(s)	263, 501, 606, 659
MaeIII	GTNAC	1 cut(s)	82
MalI	GATC	2 cut(s)	117, 205
MboI	GATC	2 cut(s)	115, 203
MboII	GAAGA	2 cut(s)	206, 647
MfeI	CAATTG	1 cut(s)	632
MhlI	GDGCHC	1 cut(s)	605
MluCI	AATT	8 cut(s)	197, 215, 279, 353, 477, 516, 558, 632
MmeI	TCCRAC	1 cut(s)	228
MnlI	CCTC	3 cut(s)	336, 355, 618
MseI	TTAA	3 cut(s)	218, 402, 557
MslI	CAYNNNNRTG	3 cut(s)	117, 123, 156
MspA1I	CMGCKG	2 cut(s)	542, 548
MspI	CCGG	1 cut(s)	474
MspR9I	CCNGG	2 cut(s)	80, 332
MunI	CAATTG	1 cut(s)	632
Mva1269I	GAATGC	1 cut(s)	615
MvaI	CCWGG	2 cut(s)	80, 332
MwoI	GCNNNNNNNGC	2 cut(s)	413, 692
NdeII	GATC	2 cut(s)	115, 203
NlaIII	CATG	8 cut(s)	116, 122, 128, 137, 161, 188, 568, 601
NlaIV	GGNNCC	2 cut(s)	163, 472
NmuCI	GTSAC	1 cut(s)	82
PagI	TCATGA	2 cut(s)	112, 597
PctI	GAATGC	1 cut(s)	615
PfeI	GAWTC	3 cut(s)	259, 536, 628
PkrI	GCNGC	5 cut(s)	383, 430, 544, 547, 589
PshBI	ATTAAT	1 cut(s)	218
PsiI	TTATAA	1 cut(s)	278
Psp6I	CCWGG	2 cut(s)	78, 330
PspFI	CCCAGC	2 cut(s)	253, 548
PspGI	CCWGG	2 cut(s)	78, 330
PspN4I	GGNNCC	2 cut(s)	163, 472
PstI	CTGCAG	2 cut(s)	418, 547
PvuII	CAGCTG	2 cut(s)	542, 548
RsaI	GTAC	3 cut(s)	50, 138, 472
RsaNI	GTAC	3 cut(s)	49, 137, 471
RseI	CAYNNNNRTG	3 cut(s)	117, 123, 156
SaqAI	TTAA	3 cut(s)	218, 402, 557
SatI	GCNGC	5 cut(s)	382, 429, 543, 546, 588
Sau3AI	GATC	2 cut(s)	115, 203
ScrFI	CCNGG	2 cut(s)	80, 332
SduI	GDGCHC	1 cut(s)	605
SetI	ASST	9 cut(s)	62, 68, 84, 109, 133, 255, 544, 550, 582
SfaNI	GCATC	3 cut(s)	308, 375, 393
SfcI	CTRYAG	2 cut(s)	414, 543
SmiMI	CAYNNNNRTG	3 cut(s)	117, 123, 156
Sse9I	AATT	8 cut(s)	197, 215, 279, 353, 477, 516, 558, 632
SsiI	CCGC	1 cut(s)	428
SspMI	CTAG	4 cut(s)	263, 501, 606, 659
StyD4I	CCNGG	2 cut(s)	78, 330
TaaI	ACNGT	3 cut(s)	37, 148, 494
TaqII	GACCGA	1 cut(s)	399
TasI	AATT	8 cut(s)	197, 215, 279, 353, 477, 516, 558, 632
TatI	WGTACW	1 cut(s)	136
TauI	GCSGC	1 cut(s)	431
TfiI	GAWTC	3 cut(s)	259, 536, 628
Tru1I	TTAA	3 cut(s)	218, 402, 557
Tru9I	TTAA	3 cut(s)	218, 402, 557
TscAI	CASTG	2 cut(s)	42, 499
TseFI	GTSAC	1 cut(s)	82
TseI	GCWGC	4 cut(s)	381, 542, 545, 587
Tsp45I	GTSAC	1 cut(s)	82
TspDTI	ATGAA	2 cut(s)	140, 586
TspRI	CASTG	2 cut(s)	42, 499
VspI	ATTAAT	1 cut(s)	218
XapI	RAATTY	1 cut(s)	477
XspI	CTAG	4 cut(s)	263, 501, 606, 659

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.