Rmu_sc0003707.1_g000006

ERF Family

Belongs to the GST superfamily

Design Primers CRISPR Design

Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0003707.1

Orthogroup ID

OG0000081

Physical Location & Seq

Genomic Coordinates Reverse (-)

19006 .. 19386

Gene Structure 381 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0003707.1_g000006.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 381 bp

atgaagatttttccacctattgtggacacattatgcagtgaagggaaagagcaagaggaagctattgtgaaagcaaaggagaacttgaagtacttattggaaggagagctaaagggaaaaaaattctttgggggagagcaaattggatttacagatattgcgctcggatggcttgcacaccatgagaacgtgtttgaagaggtagctaatgtgaagctgatagcagaagatgagttcccattgttatcagaatggcaaaagactttcacacatgttcctatgatcaaagagaattggccttctagagacaaacttatcactaaatttctggctatccgtgagcgtgaacttgtcaagaagctgaagaaggcacctaaatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0001101 GO:0003674 GO:0003824 GO:0004364 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0006518 GO:0006575 GO:0006749 GO:0006790 GO:0006807 GO:0006950 GO:0008150 GO:0008152 GO:0009056 GO:0009266 GO:0009404 GO:0009407 GO:0009408 GO:0009628 GO:0009636 GO:0009719 GO:0009725 GO:0009733 GO:0009735 GO:0009737 GO:0009739 GO:0009987 GO:0010033 GO:0010035 GO:0010038 GO:0016740 GO:0016765 GO:0019748 GO:0033993 GO:0034641 GO:0042221 GO:0043603 GO:0044237 GO:0044248 GO:0044424 GO:0044464 GO:0050896 GO:0051186 GO:0071704 GO:0097305 GO:0098754 GO:1901564 GO:1901700

KEGG Pathways

Metabolic & Signaling

ko00480 ko00980 ko00982 ko00983 ko01524 ko05200 ko05204 ko05225 ko05418 map00480 map00980 map00982 map00983 map01524 map05200 map05204 map05225 map05418

Pfam Domains

Protein Families

GST_C GST_N

Protein Analysis

126

Amino Acids

14.58

Weight (kDa)

6.85

Isoelectric Point (pI)

21.89

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000081)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G29420
fragaria_vesca	FvH4_2g20010 FvH4_2g20020 FvH4_2g20030 FvH4_2g20060 FvH4_2g20070 FvH4_2g20080 FvH4_2g20091 FvH4_2g20110 FvH4_4g05320 FvH4_4g05350 FvH4_4g05360 FvH4_4g12720 FvH4_5g16920 FvH4_5g16920 FvH4_5g16920 FvH4_5g16920 FvH4_5g36020 FvH4_5g36870 FvH4_7g07360 FvH4_7g07390 FvH4_7g09460 FvH4_7g09460 FvH4_7g09460 FvH4_7g09460 FvH4_7g09460
malus_domestica	MD00G1136300.v1.1 MD02G1236000.v1.1 MD02G1236100.v1.1 MD05G1184200.v1.1 MD05G1184300.v1.1 MD05G1184400.v1.1 MD05G1184600.v1.1 MD10G1172100.v1.1 MD10G1172200.v1.1 MD10G1172300.v1.1 MD13G1227600.v1.1 MD14G1232100.v1.1 MD14G1232200.v1.1 MD16G1011600.v1.1 MD16G1232800.v1.1 MD16G1232900.v1.1
prunus_persica	Prupe.1G039900_v2.0.a1 Prupe.1G054800_v2.0.a1 Prupe.1G054900_v2.0.a1 Prupe.1G055000_v2.0.a1 Prupe.1G055300_v2.0.a1 Prupe.1G055900_v2.0.a1 Prupe.1G056000_v2.0.a1 Prupe.1G056100_v2.0.a1 Prupe.1G526000_v2.0.a1 Prupe.2G101400_v2.0.a1 Prupe.2G101500_v2.0.a1 Prupe.2G101600_v2.0.a1 Prupe.5G228000_v2.0.a1 Prupe.5G228100_v2.0.a1 Prupe.8G210200_v2.0.a1 Prupe.8G210300_v2.0.a1 Prupe.8G210400_v2.0.a1 Prupe.8G210500_v2.0.a1 Prupe.8G210600_v2.0.a1 Prupe.8G210700_v2.0.a1 Prupe.8G210800_v2.0.a1 Prupe.8G210800_v2.0.a1
pyrus_communis	pycom02g20280 pycom02g20290 pycom02g20300 pycom05g16920 pycom05g16930 pycom05g16940 pycom07g06270 pycom10g14850 pycom10g14860 pycom10g14870 pycom14g19350 pycom16g19480
rosa_chinensis	RchiOBHm_Chr1g0327741 RchiOBHm_Chr1g0339611 RchiOBHm_Chr1g0339631 RchiOBHm_Chr1g0339651 RchiOBHm_Chr1g0339671 RchiOBHm_Chr1g0339691 RchiOBHm_Chr1g0339761 RchiOBHm_Chr1g0339771 RchiOBHm_Chr1g0339781 RchiOBHm_Chr1g0364471 RchiOBHm_Chr1g0364481 RchiOBHm_Chr1g0364501 RchiOBHm_Chr1g0364511 RchiOBHm_Chr4g0396351 RchiOBHm_Chr4g0396391 RchiOBHm_Chr4g0396421 RchiOBHm_Chr4g0396431 RchiOBHm_Chr4g0396441 RchiOBHm_Chr4g0396461 RchiOBHm_Chr4g0396521 RchiOBHm_Chr4g0400161 RchiOBHm_Chr6g0285721 RchiOBHm_Chr6g0285731 RchiOBHm_Chr6g0285741 RchiOBHm_Chr6g0285761 RchiOBHm_Chr6g0285771 RchiOBHm_Chr6g0285781 RchiOBHm_Chr6g0285791 RchiOBHm_Chr6g0285801 RchiOBHm_Chr6g0285821 RchiOBHm_Chr6g0285831 RchiOBHm_Chr7g0179081 RchiOBHm_Chr7g0179091 RchiOBHm_Chr7g0179101 RchiOBHm_Chr7g0215201 RchiOBHm_Chr7g0237741
rosa_laevigata	RLG00000000971 RLG00000002403 RLG00000005385 RLG00000005386 RLG00000005387 RLG00000009530 RLG00000009533 RLG00000009534 RLG00000009545 RLG00000009547 RLG00000009548 RLG00000012606 RLG00000012607 RLG00000012608 RLG00000012609 RLG00000012612 RLG00000012613 RLG00000012614 RLG00000015071 RLG00000020454 RLG00000020455 RLG00000027472 RLG00000027473 RLG00000027474 RLG00000027477 RLG00000029240 RLG00000029241
rosa_multiflora	Rmu_co8321391.1_g000001 Rmu_co8330237.1_g000001 Rmu_sc0000037.1_g000019 Rmu_sc0000483.1_g000002 Rmu_sc0000511.1_g000018 Rmu_sc0000888.1_g000016 Rmu_sc0000888.1_g000017 Rmu_sc0001356.1_g000009 Rmu_sc0001356.1_g000010 Rmu_sc0001781.1_g000011 Rmu_sc0001781.1_g000020 Rmu_sc0001781.1_g000022 Rmu_sc0001781.1_g000023 Rmu_sc0001781.1_g000043 Rmu_sc0002862.1_g000013 Rmu_sc0003707.1_g000006 Rmu_sc0003707.1_g000007 Rmu_sc0003919.1_g000009 Rmu_sc0004321.1_g000006 Rmu_sc0005500.1_g000001 Rmu_sc0007814.1_g000001 Rmu_sc0007814.1_g000002 Rmu_sc0007814.1_g000010 Rmu_sc0009238.1_g000007 Rmu_sc0009409.1_g000003 Rmu_sc0011138.1_g000004 Rmu_sc0013252.1_g000003 Rmu_sc0017632.1_g000005 Rmu_sc0021325.1_g000002 Rmu_sc0021325.1_g000004 Rmu_sc0021325.1_g000005 Rmu_sc0021325.1_g000008 Rmu_sc0021325.1_g000009 Rmu_sc0028323.1_g000001 Rmu_sc0036111.1_g000001 Rmu_sc0041231.1_g000001 Rmu_ssc0000067.1_g000034 Rmu_ssc0000234.1_g000019 Rmu_ssc0000278.1_g000016
rosa_roxburghii	Rroxscaffold_3G00244460 Rroxscaffold_3G00274390 Rroxscaffold_3G00274400 Rroxscaffold_3G00274410 Rroxscaffold_4G00291800 Rroxscaffold_4G00291810 Rroxscaffold_4G00292220 Rroxscaffold_4G00292230 Rroxscaffold_4G00292250 Rroxscaffold_4G00313630 Rroxscaffold_4G00313640 Rroxscaffold_4G00313650 Rroxscaffold_4G00313660 Rroxscaffold_4G00313670 Rroxscaffold_4G00313690 Rroxscaffold_5G00341170 Rroxscaffold_5G00341180 Rroxscaffold_5G00341200 Rroxscaffold_5G00341210 Rroxscaffold_5G00341340 Rroxscaffold_5G00341350 Rroxscaffold_5G00341360 Rroxscaffold_5G00341380 Rroxscaffold_5G00345120 Rroxscaffold_7G00182670 Rroxscaffold_7G00182680 Rroxscaffold_7G00182700 Rroxscaffold_7G00182710 Rroxscaffold_7G00182730 Rroxscaffold_7G00182770 Rroxscaffold_7G00182790 Rroxscaffold_7G00182800 Rroxscaffold_7G00212460
rosa_rugosa	Rorug01G0139800.1 Rorug01G0140000.1 Rorug03G0349500 Rorug03G0349500 Rorug03G0349500 Rorug03G0349600 Rorug03G0349600 Rorug04G0023100 Rorug05G0538200 Rorug06G0176800 Rorug06G0177100 Rorug06G0420800 Rorug06G0420900 Rorug06G0421000 Rorug07G0307700
rosa_samantha	Rh1AG086600 Rh1AG324800 Rh1DG318900 Rh4AG067600 Rh4AG068400 Rh4AG069200 Rh4BG096900 Rh4CG073400 Rh4CG073900 Rh4CG074500 Rh4DG063500 Rh4DG063700 Rh4DG063800 Rh4DG064000 Rh4DG093500 Rh6AG288300 Rh6AG288400 Rh6AG288500 Rh6AG288600 Rh6AG288700 Rh6AG288800 Rh6BG289900 Rh6BG290000 Rh6BG290100 Rh6BG290400 Rh6BG290800 Rh6BG290900 Rh6CG047000 Rh6CG290900 Rh6CG291000 Rh6CG291100 Rh6CG291300 Rh6CG291400 Rh6CG291500 Rh6CG291600 Rh6CG291700 Rh6CG291800 Rh6DG042500 Rh7AG020300 Rh7AG287600 Rh7BG020000 Rh7CG021200 Rh7CG021400 Rh7CG307400 Rh7DG020900
rosa_wichuraiana	Rw0G006240 Rw0G019430 Rw1G013000 Rw1G013020 Rw1G013040 Rw1G013070 Rw1G013090 Rw1G028790 Rw1G028800 Rw1G028810 Rw4G005480 Rw4G005500 Rw4G005520 Rw4G005530 Rw4G005540 Rw4G005560 Rw4G005570 Rw6G004910 Rw6G024770 Rw6G024780 Rw6G024790 Rw6G024800 Rw6G024810 Rw6G024820 Rw6G024830 Rw6G024840 Rw6G024850 Rw6G024860 Rw6G024870 Rw6G024880 Rw6G024890 Rw7G001680 Rw7G001690 Rw7G001700 Rw7G038360

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	370
AcsI	RAATTY	2 cut(s)	122, 323
AfaI	GTAC	1 cut(s)	92
AflIII	ACRYGT	2 cut(s)	189, 271
AgsI	TTSAA	2 cut(s)	88, 197
AjuI	GAANNNNNNNTTGG	2 cut(s)	80, 112
AluBI	AGCT	5 cut(s)	62, 109, 206, 217, 361
AluI	AGCT	5 cut(s)	62, 109, 206, 217, 361
Alw26I	GTCTC	1 cut(s)	300
AoxI	GGCC	1 cut(s)	296
ApoI	RAATTY	2 cut(s)	122, 323
AspLEI	GCGC	1 cut(s)	163
BanI	GGYRCC	1 cut(s)	370
BccI	CCATC	1 cut(s)	162
BclI	TGATCA	1 cut(s)	282
BcoDI	GTCTC	1 cut(s)	300
BfaI	CTAG	1 cut(s)	303
BmcAI	AGTACT	1 cut(s)	92
BmiI	GGNNCC	1 cut(s)	372
BseGI	GGATG	1 cut(s)	173
BshFI	GGCC	1 cut(s)	298
BshNI	GGYRCC	1 cut(s)	370
BsmAI	GTCTC	1 cut(s)	300
BsnI	GGCC	1 cut(s)	298
Bsp143I	GATC	1 cut(s)	282
BspANI	GGCC	1 cut(s)	298
BspLI	GGNNCC	1 cut(s)	372
BspT107I	GGYRCC	1 cut(s)	370
BssMI	GATC	1 cut(s)	282
Bst6I	CTCTTC	1 cut(s)	192
BstC8I	GCNNGC	1 cut(s)	174
BstF5I	GGATG	1 cut(s)	173
BstHHI	GCGC	1 cut(s)	163
BstKTI	GATC	1 cut(s)	285
BstMAI	GTCTC	1 cut(s)	300
BstMBI	GATC	1 cut(s)	282
BstMWI	GCNNNNNNNGC	1 cut(s)	169
BstNSI	RCATGY	1 cut(s)	275
BsuRI	GGCC	1 cut(s)	298
BtsCI	GGATG	1 cut(s)	173
BtsI	GCAGTG	1 cut(s)	43
BtsIMutI	CAGTG	1 cut(s)	43
Cac8I	GCNNGC	1 cut(s)	174
CfoI	GCGC	1 cut(s)	163
Csp6I	GTAC	1 cut(s)	91
CviAII	CATG	2 cut(s)	182, 272
CviJI	RGCY	8 cut(s)	62, 109, 172, 206, 217, 298, 332, 361
CviKI_1	RGCY	8 cut(s)	62, 109, 172, 206, 217, 298, 332, 361
CviQI	GTAC	1 cut(s)	91
DpnI	GATC	1 cut(s)	284
DpnII	GATC	1 cut(s)	282
Eam1104I	CTCTTC	1 cut(s)	192
EarI	CTCTTC	1 cut(s)	192
FaeI	CATG	2 cut(s)	185, 275
FaiI	YATR	4 cut(s)	34, 183, 273, 281
FalI	AAGNNNNNCTT	2 cut(s)	68, 100
FatI	CATG	2 cut(s)	181, 271
FbaI	TGATCA	1 cut(s)	282
FokI	GGATG	1 cut(s)	180
FspBI	CTAG	1 cut(s)	303
GlaI	GCGC	1 cut(s)	162
HaeIII	GGCC	1 cut(s)	298
HhaI	GCGC	1 cut(s)	163
Hin1II	CATG	2 cut(s)	185, 275
Hin6I	GCGC	1 cut(s)	161
HinP1I	GCGC	1 cut(s)	161
Hpy166II	GTNNAC	2 cut(s)	25, 347
Hpy188I	TCNGA	2 cut(s)	167, 250
Hpy188III	TCNNGA	2 cut(s)	303, 355
Hpy8I	GTNNAC	2 cut(s)	25, 347
HpyAV	CCTTC	4 cut(s)	35, 95, 309, 361
HpyCH4IV	ACGT	1 cut(s)	189
HpyCH4V	TGCA	2 cut(s)	36, 176
HpyF10VI	GCNNNNNNNGC	1 cut(s)	169
HpySE526I	ACGT	1 cut(s)	189
Hsp92II	CATG	2 cut(s)	185, 275
HspAI	GCGC	1 cut(s)	161
Ksp22I	TGATCA	1 cut(s)	282
Kzo9I	GATC	1 cut(s)	282
LpnPI	CCDG	1 cut(s)	314
MaeI	CTAG	1 cut(s)	303
MaeII	ACGT	1 cut(s)	189
MalI	GATC	1 cut(s)	284
MboI	GATC	1 cut(s)	282
MboII	GAAGA	4 cut(s)	16, 209, 239, 376
MluCI	AATT	4 cut(s)	122, 141, 292, 323
MnlI	CCTC	2 cut(s)	49, 193
MslI	CAYNNNNRTG	1 cut(s)	376
MwoI	GCNNNNNNNGC	1 cut(s)	169
NdeII	GATC	1 cut(s)	282
NlaIII	CATG	2 cut(s)	185, 275
NlaIV	GGNNCC	1 cut(s)	372
NspI	RCATGY	1 cut(s)	275
PciI	ACATGT	1 cut(s)	271
PscI	ACATGT	1 cut(s)	271
PspN4I	GGNNCC	1 cut(s)	372
PsrI	GAACNNNNNNTAC	2 cut(s)	74, 106
RsaI	GTAC	1 cut(s)	92
RsaNI	GTAC	1 cut(s)	91
RseI	CAYNNNNRTG	1 cut(s)	376
Sau3AI	GATC	1 cut(s)	282
ScaI	AGTACT	1 cut(s)	92
SetI	ASST	9 cut(s)	19, 64, 111, 192, 204, 208, 219, 363, 376
SmiMI	CAYNNNNRTG	1 cut(s)	376
Sse9I	AATT	4 cut(s)	122, 141, 292, 323
SspMI	CTAG	1 cut(s)	303
TaiI	ACGT	1 cut(s)	192
TasI	AATT	4 cut(s)	122, 141, 292, 323
TatI	WGTACW	1 cut(s)	90
TscAI	CASTG	1 cut(s)	43
TspDTI	ATGAA	1 cut(s)	17
TspGWI	ACGGA	1 cut(s)	326
TspRI	CASTG	1 cut(s)	43
XapI	RAATTY	2 cut(s)	122, 323
XbaI	TCTAGA	1 cut(s)	302
XceI	RCATGY	1 cut(s)	275
XspI	CTAG	1 cut(s)	303
ZrmI	AGTACT	1 cut(s)	92

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.