Rh6CG291500

Glutathione transferase GST 23-like

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
Physical Location & Seq
Forward (+)
46887268 .. 46887489
222 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG291500.1

Sequence Viewer

Length: 222 bp
ATGGCTGATTTAGAATTTGGATGGCTAGCTTGGTGGCTGGAAGTCTTGAGTGAAGTAGCTGGGGTTAAAGCGATTGAAGTCGAAAGCTTCCCTCGCTTACATGCATGGATTCAAAGGTTCAAGGAGATTCCCACAATCAAAGAGACCCTTCCTGATCGCAGTGCAATGTTGACCCATTGCAAAGATCGAAGAGCAAGATTTCTTGCTTTAGCAAAATCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

73

Amino Acids

8.51

Weight (kDa)

7.95

Isoelectric Point (pI)

40.4

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF7962 PF25907 1 - 43 7.5e-06 Domain of unknown function (DUF7962)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000081)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G29420
fragaria_vesca FvH4_2g20010 FvH4_2g20020 FvH4_2g20030 FvH4_2g20060 FvH4_2g20070 FvH4_2g20080 FvH4_2g20091 FvH4_2g20110 FvH4_4g05320 FvH4_4g05350 FvH4_4g05360 FvH4_4g12720 FvH4_5g16920 FvH4_5g16920 FvH4_5g16920 FvH4_5g16920 FvH4_5g36020 FvH4_5g36870 FvH4_7g07360 FvH4_7g07390 FvH4_7g09460 FvH4_7g09460 FvH4_7g09460 FvH4_7g09460 FvH4_7g09460
malus_domestica MD00G1136300.v1.1 MD02G1236000.v1.1 MD02G1236100.v1.1 MD05G1184200.v1.1 MD05G1184300.v1.1 MD05G1184400.v1.1 MD05G1184600.v1.1 MD10G1172100.v1.1 MD10G1172200.v1.1 MD10G1172300.v1.1 MD13G1227600.v1.1 MD14G1232100.v1.1 MD14G1232200.v1.1 MD16G1011600.v1.1 MD16G1232800.v1.1 MD16G1232900.v1.1
prunus_persica Prupe.1G039900_v2.0.a1 Prupe.1G054800_v2.0.a1 Prupe.1G054900_v2.0.a1 Prupe.1G055000_v2.0.a1 Prupe.1G055300_v2.0.a1 Prupe.1G055900_v2.0.a1 Prupe.1G056000_v2.0.a1 Prupe.1G056100_v2.0.a1 Prupe.1G526000_v2.0.a1 Prupe.2G101400_v2.0.a1 Prupe.2G101500_v2.0.a1 Prupe.2G101600_v2.0.a1 Prupe.5G228000_v2.0.a1 Prupe.5G228100_v2.0.a1 Prupe.8G210200_v2.0.a1 Prupe.8G210300_v2.0.a1 Prupe.8G210400_v2.0.a1 Prupe.8G210500_v2.0.a1 Prupe.8G210600_v2.0.a1 Prupe.8G210700_v2.0.a1 Prupe.8G210800_v2.0.a1 Prupe.8G210800_v2.0.a1
pyrus_communis pycom02g20280 pycom02g20290 pycom02g20300 pycom05g16920 pycom05g16930 pycom05g16940 pycom07g06270 pycom10g14850 pycom10g14860 pycom10g14870 pycom14g19350 pycom16g19480
rosa_chinensis RchiOBHm_Chr1g0327741 RchiOBHm_Chr1g0339611 RchiOBHm_Chr1g0339631 RchiOBHm_Chr1g0339651 RchiOBHm_Chr1g0339671 RchiOBHm_Chr1g0339691 RchiOBHm_Chr1g0339761 RchiOBHm_Chr1g0339771 RchiOBHm_Chr1g0339781 RchiOBHm_Chr1g0364471 RchiOBHm_Chr1g0364481 RchiOBHm_Chr1g0364501 RchiOBHm_Chr1g0364511 RchiOBHm_Chr4g0396351 RchiOBHm_Chr4g0396391 RchiOBHm_Chr4g0396421 RchiOBHm_Chr4g0396431 RchiOBHm_Chr4g0396441 RchiOBHm_Chr4g0396461 RchiOBHm_Chr4g0396521 RchiOBHm_Chr4g0400161 RchiOBHm_Chr6g0285721 RchiOBHm_Chr6g0285731 RchiOBHm_Chr6g0285741 RchiOBHm_Chr6g0285761 RchiOBHm_Chr6g0285771 RchiOBHm_Chr6g0285781 RchiOBHm_Chr6g0285791 RchiOBHm_Chr6g0285801 RchiOBHm_Chr6g0285821 RchiOBHm_Chr6g0285831 RchiOBHm_Chr7g0179081 RchiOBHm_Chr7g0179091 RchiOBHm_Chr7g0179101 RchiOBHm_Chr7g0215201 RchiOBHm_Chr7g0237741
rosa_laevigata RLG00000000971 RLG00000002403 RLG00000005385 RLG00000005386 RLG00000005387 RLG00000009530 RLG00000009533 RLG00000009534 RLG00000009545 RLG00000009547 RLG00000009548 RLG00000012606 RLG00000012607 RLG00000012608 RLG00000012609 RLG00000012612 RLG00000012613 RLG00000012614 RLG00000015071 RLG00000020454 RLG00000020455 RLG00000027472 RLG00000027473 RLG00000027474 RLG00000027477 RLG00000029240 RLG00000029241
rosa_multiflora Rmu_co8321391.1_g000001 Rmu_co8330237.1_g000001 Rmu_sc0000037.1_g000019 Rmu_sc0000483.1_g000002 Rmu_sc0000511.1_g000018 Rmu_sc0000888.1_g000016 Rmu_sc0000888.1_g000017 Rmu_sc0001356.1_g000009 Rmu_sc0001356.1_g000010 Rmu_sc0001781.1_g000011 Rmu_sc0001781.1_g000020 Rmu_sc0001781.1_g000022 Rmu_sc0001781.1_g000023 Rmu_sc0001781.1_g000043 Rmu_sc0002862.1_g000013 Rmu_sc0003707.1_g000006 Rmu_sc0003707.1_g000007 Rmu_sc0003919.1_g000009 Rmu_sc0004321.1_g000006 Rmu_sc0005500.1_g000001 Rmu_sc0007814.1_g000001 Rmu_sc0007814.1_g000002 Rmu_sc0007814.1_g000010 Rmu_sc0009238.1_g000007 Rmu_sc0009409.1_g000003 Rmu_sc0011138.1_g000004 Rmu_sc0013252.1_g000003 Rmu_sc0017632.1_g000005 Rmu_sc0021325.1_g000002 Rmu_sc0021325.1_g000004 Rmu_sc0021325.1_g000005 Rmu_sc0021325.1_g000008 Rmu_sc0021325.1_g000009 Rmu_sc0028323.1_g000001 Rmu_sc0036111.1_g000001 Rmu_sc0041231.1_g000001 Rmu_ssc0000067.1_g000034 Rmu_ssc0000234.1_g000019 Rmu_ssc0000278.1_g000016
rosa_roxburghii Rroxscaffold_3G00244460 Rroxscaffold_3G00274390 Rroxscaffold_3G00274400 Rroxscaffold_3G00274410 Rroxscaffold_4G00291800 Rroxscaffold_4G00291810 Rroxscaffold_4G00292220 Rroxscaffold_4G00292230 Rroxscaffold_4G00292250 Rroxscaffold_4G00313630 Rroxscaffold_4G00313640 Rroxscaffold_4G00313650 Rroxscaffold_4G00313660 Rroxscaffold_4G00313670 Rroxscaffold_4G00313690 Rroxscaffold_5G00341170 Rroxscaffold_5G00341180 Rroxscaffold_5G00341200 Rroxscaffold_5G00341210 Rroxscaffold_5G00341340 Rroxscaffold_5G00341350 Rroxscaffold_5G00341360 Rroxscaffold_5G00341380 Rroxscaffold_5G00345120 Rroxscaffold_7G00182670 Rroxscaffold_7G00182680 Rroxscaffold_7G00182700 Rroxscaffold_7G00182710 Rroxscaffold_7G00182730 Rroxscaffold_7G00182770 Rroxscaffold_7G00182790 Rroxscaffold_7G00182800 Rroxscaffold_7G00212460
rosa_rugosa Rorug01G0139800.1 Rorug01G0140000.1 Rorug03G0349500 Rorug03G0349500 Rorug03G0349500 Rorug03G0349600 Rorug03G0349600 Rorug04G0023100 Rorug05G0538200 Rorug06G0176800 Rorug06G0177100 Rorug06G0420800 Rorug06G0420900 Rorug06G0421000 Rorug07G0307700
rosa_samantha Rh1AG086600 Rh1AG324800 Rh1DG318900 Rh4AG067600 Rh4AG068400 Rh4AG069200 Rh4BG096900 Rh4CG073400 Rh4CG073900 Rh4CG074500 Rh4DG063500 Rh4DG063700 Rh4DG063800 Rh4DG064000 Rh4DG093500 Rh6AG288300 Rh6AG288400 Rh6AG288500 Rh6AG288600 Rh6AG288700 Rh6AG288800 Rh6BG289900 Rh6BG290000 Rh6BG290100 Rh6BG290400 Rh6BG290800 Rh6BG290900 Rh6CG047000 Rh6CG290900 Rh6CG291000 Rh6CG291100 Rh6CG291300 Rh6CG291400 Rh6CG291500 Rh6CG291600 Rh6CG291700 Rh6CG291800 Rh6DG042500 Rh7AG020300 Rh7AG287600 Rh7BG020000 Rh7CG021200 Rh7CG021400 Rh7CG307400 Rh7DG020900
rosa_wichuraiana Rw0G006240 Rw0G019430 Rw1G013000 Rw1G013020 Rw1G013040 Rw1G013070 Rw1G013090 Rw1G028790 Rw1G028800 Rw1G028810 Rw4G005480 Rw4G005500 Rw4G005520 Rw4G005530 Rw4G005540 Rw4G005560 Rw4G005570 Rw6G004910 Rw6G024770 Rw6G024780 Rw6G024790 Rw6G024800 Rw6G024810 Rw6G024820 Rw6G024830 Rw6G024840 Rw6G024850 Rw6G024860 Rw6G024870 Rw6G024880 Rw6G024890 Rw7G001680 Rw7G001690 Rw7G001700 Rw7G038360

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 14
AgsI TTSAA 3 cut(s) 77, 113, 121
AluBI AGCT 3 cut(s) 29, 59, 87
AluI AGCT 3 cut(s) 29, 59, 87
Alw26I GTCTC 1 cut(s) 137
ApoI RAATTY 1 cut(s) 14
AsuNHI GCTAGC 1 cut(s) 25
BccI CCATC 1 cut(s) 15
BcoDI GTCTC 1 cut(s) 137
BfaI CTAG 1 cut(s) 26
BmtI GCTAGC 1 cut(s) 29
BpuEI CTTGAG 1 cut(s) 67
BsaI GGTCTC 1 cut(s) 137
Bse3DI GCAATG 2 cut(s) 171, 175
BseGI GGATG 1 cut(s) 26
BseMI GCAATG 2 cut(s) 171, 175
BseYI CCCAGC 1 cut(s) 59
BsmAI GTCTC 1 cut(s) 137
Bso31I GGTCTC 1 cut(s) 137
Bsp143I GATC 2 cut(s) 154, 184
BspOI GCTAGC 1 cut(s) 29
BspQI GCTCTTC 1 cut(s) 184
BspTNI GGTCTC 1 cut(s) 137
BsrDI GCAATG 2 cut(s) 171, 175
BssMI GATC 2 cut(s) 154, 184
Bst6I CTCTTC 1 cut(s) 184
BstC8I GCNNGC 1 cut(s) 27
BstF5I GGATG 1 cut(s) 26
BstKTI GATC 2 cut(s) 157, 187
BstMAI GTCTC 1 cut(s) 137
BstMBI GATC 2 cut(s) 154, 184
BstMWI GCNNNNNNNGC 1 cut(s) 93
BstNSI RCATGY 1 cut(s) 104
BtsCI GGATG 1 cut(s) 26
BtsI GCAGTG 1 cut(s) 166
BtsIMutI CAGTG 1 cut(s) 166
Cac8I GCNNGC 1 cut(s) 27
CviAII CATG 2 cut(s) 101, 105
CviJI RGCY 6 cut(s) 5, 25, 29, 37, 59, 87
CviKI_1 RGCY 6 cut(s) 5, 25, 29, 37, 59, 87
DpnI GATC 2 cut(s) 156, 186
DpnII GATC 2 cut(s) 154, 184
Eam1104I CTCTTC 1 cut(s) 184
EarI CTCTTC 1 cut(s) 184
Eco31I GGTCTC 1 cut(s) 137
EcoT22I ATGCAT 1 cut(s) 106
FaeI CATG 2 cut(s) 104, 108
FaiI YATR 2 cut(s) 102, 106
FalI AAGNNNNNCTT 2 cut(s) 132, 164
FatI CATG 2 cut(s) 100, 104
FokI GGATG 1 cut(s) 33
FspBI CTAG 1 cut(s) 26
GsaI CCCAGC 1 cut(s) 63
Hin1II CATG 2 cut(s) 104, 108
HincII GTYRAC 1 cut(s) 171
HindII GTYRAC 1 cut(s) 171
HindIII AAGCTT 1 cut(s) 85
HinfI GANTC 2 cut(s) 109, 127
Hpy166II GTNNAC 1 cut(s) 171
Hpy188III TCNNGA 2 cut(s) 46, 152
Hpy8I GTNNAC 1 cut(s) 171
HpyAV CCTTC 1 cut(s) 158
HpyCH4V TGCA 3 cut(s) 104, 164, 180
HpyF10VI GCNNNNNNNGC 1 cut(s) 93
Hsp92II CATG 2 cut(s) 104, 108
Kzo9I GATC 2 cut(s) 154, 184
LguI GCTCTTC 1 cut(s) 184
LpnPI CCDG 3 cut(s) 23, 45, 165
MaeI CTAG 1 cut(s) 26
MalI GATC 2 cut(s) 156, 186
MboI GATC 2 cut(s) 154, 184
MboII GAAGA 1 cut(s) 201
MluCI AATT 1 cut(s) 14
MnlI CCTC 1 cut(s) 102
Mph1103I ATGCAT 1 cut(s) 106
MseI TTAA 2 cut(s) 66, 220
MwoI GCNNNNNNNGC 1 cut(s) 93
NdeII GATC 2 cut(s) 154, 184
NheI GCTAGC 1 cut(s) 25
NlaIII CATG 2 cut(s) 104, 108
NsiI ATGCAT 1 cut(s) 106
NspI RCATGY 1 cut(s) 104
PciSI GCTCTTC 1 cut(s) 184
PfeI GAWTC 2 cut(s) 109, 127
PspFI CCCAGC 1 cut(s) 59
SapI GCTCTTC 1 cut(s) 184
SaqAI TTAA 2 cut(s) 66, 220
Sau3AI GATC 2 cut(s) 154, 184
SetI ASST 4 cut(s) 31, 61, 89, 119
SmlI CTYRAG 1 cut(s) 46
SmoI CTYRAG 1 cut(s) 46
Sse9I AATT 1 cut(s) 14
SspMI CTAG 1 cut(s) 26
TaqI TCGA 2 cut(s) 81, 187
TasI AATT 1 cut(s) 14
TfiI GAWTC 2 cut(s) 109, 127
Tru1I TTAA 2 cut(s) 66, 220
Tru9I TTAA 2 cut(s) 66, 220
TscAI CASTG 1 cut(s) 166
TspRI CASTG 1 cut(s) 166
XapI RAATTY 1 cut(s) 14
XceI RCATGY 1 cut(s) 104
XspI CTAG 1 cut(s) 26
Zsp2I ATGCAT 1 cut(s) 106
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.