Rmu_sc0004517.1_g000001

DEAD DEAH box RNA helicase family protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004517.1
Physical Location & Seq
Forward (+)
1 .. 227
227 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004517.1_g000001.1.cds

Sequence Viewer

Length: 227 bp
tgcaatcagaggctgcaggcagaaatatgcagcacagtgatgcacatggggacatgctttatgatgatcagttttatgaggatcttgatcttgacgcattggaagcacaagctacaattcttcttaagcagaaatcagaattgccactgcagaagccacagatgtgtcagttaaacccagaaaatcctactcttgacagtgctccatcatttgatcttgggatatga

Protein Analysis

74

Amino Acids

8.26

Weight (kDa)

4.09

Isoelectric Point (pI)

49.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 89
AflII CTTAAG 1 cut(s) 124
AleI CACNNNNGTG 1 cut(s) 162
AluBI AGCT 1 cut(s) 112
AluI AGCT 1 cut(s) 112
Alw21I GWGCWC 1 cut(s) 204
AlwI GGATC 1 cut(s) 89
AlwNI CAGNNNCTG 1 cut(s) 13
ApeKI GCWGC 2 cut(s) 13, 30
Bbv12I GWGCWC 1 cut(s) 204
BbvI GCAGC 1 cut(s) 42
BccI CCATC 1 cut(s) 213
BclI TGATCA 1 cut(s) 66
BfmI CTRYAG 2 cut(s) 14, 148
BfrI CTTAAG 1 cut(s) 124
BisI GCNGC 2 cut(s) 14, 31
BlsI GCNGC 2 cut(s) 15, 32
BmsI GCATC 1 cut(s) 30
BsaBI GATNNNNATC 1 cut(s) 86
Bse8I GATNNNNATC 1 cut(s) 86
BseJI GATNNNNATC 1 cut(s) 86
BseXI GCAGC 1 cut(s) 42
BsiHKAI GWGCWC 1 cut(s) 204
BslFI GGGAC 1 cut(s) 64
BsmFI GGGAC 1 cut(s) 64
Bsp1286I GDGCHC 1 cut(s) 204
Bsp143I GATC 4 cut(s) 66, 81, 87, 213
BspMAI CTGCAG 2 cut(s) 18, 152
BspPI GGATC 1 cut(s) 89
BspTI CTTAAG 1 cut(s) 124
BssMI GATC 4 cut(s) 66, 81, 87, 213
Bst4CI ACNGT 2 cut(s) 37, 199
BstAFI CTTAAG 1 cut(s) 124
BstC8I GCNNGC 1 cut(s) 18
BstKTI GATC 4 cut(s) 69, 84, 90, 216
BstMBI GATC 4 cut(s) 66, 81, 87, 213
BstMWI GCNNNNNNNGC 1 cut(s) 103
BstNSI RCATGY 1 cut(s) 57
BstSFI CTRYAG 2 cut(s) 14, 148
BstV1I GCAGC 1 cut(s) 42
BstX2I RGATCY 1 cut(s) 81
BstYI RGATCY 1 cut(s) 81
BtsI GCAGTG 1 cut(s) 145
BtsIMutI CAGTG 3 cut(s) 42, 145, 204
Cac8I GCNNGC 1 cut(s) 18
CaiI CAGNNNCTG 1 cut(s) 13
CseI GACGC 1 cut(s) 103
CviAII CATG 2 cut(s) 46, 54
CviJI RGCY 3 cut(s) 13, 112, 156
CviKI_1 RGCY 3 cut(s) 13, 112, 156
DpnI GATC 4 cut(s) 68, 83, 89, 215
DpnII GATC 4 cut(s) 66, 81, 87, 213
FaeI CATG 2 cut(s) 49, 57
FaiI YATR 6 cut(s) 28, 47, 55, 62, 77, 225
FaqI GGGAC 1 cut(s) 64
FatI CATG 2 cut(s) 45, 53
FbaI TGATCA 1 cut(s) 66
Fnu4HI GCNGC 2 cut(s) 14, 31
Fsp4HI GCNGC 2 cut(s) 14, 31
GluI GCNGC 2 cut(s) 14, 31
HgaI GACGC 1 cut(s) 103
Hin1II CATG 2 cut(s) 49, 57
Hpy188I TCNGA 2 cut(s) 9, 138
Hpy188III TCNNGA 3 cut(s) 85, 91, 193
HpyCH4III ACNGT 2 cut(s) 37, 199
HpyCH4V TGCA 5 cut(s) 3, 16, 30, 43, 150
HpyF10VI GCNNNNNNNGC 1 cut(s) 103
Hsp92II CATG 2 cut(s) 49, 57
Ksp22I TGATCA 1 cut(s) 66
Kzo9I GATC 4 cut(s) 66, 81, 87, 213
LmnI GCTCC 1 cut(s) 207
LpnPI CCDG 2 cut(s) 2, 191
Lsp1109I GCAGC 1 cut(s) 42
LweI GCATC 1 cut(s) 30
MalI GATC 4 cut(s) 68, 83, 89, 215
MboI GATC 4 cut(s) 66, 81, 87, 213
MboII GAAGA 1 cut(s) 112
MflI RGATCY 1 cut(s) 81
MhlI GDGCHC 1 cut(s) 204
MluCI AATT 2 cut(s) 116, 139
MnlI CCTC 2 cut(s) 3, 72
MseI TTAA 2 cut(s) 125, 172
MslI CAYNNNNRTG 2 cut(s) 38, 162
MspCI CTTAAG 1 cut(s) 124
MwoI GCNNNNNNNGC 1 cut(s) 103
NdeII GATC 4 cut(s) 66, 81, 87, 213
NlaIII CATG 2 cut(s) 49, 57
NspI RCATGY 1 cut(s) 57
OliI CACNNNNGTG 1 cut(s) 162
PkrI GCNGC 2 cut(s) 15, 32
PstI CTGCAG 2 cut(s) 18, 152
PstNI CAGNNNCTG 1 cut(s) 13
PsuI RGATCY 1 cut(s) 81
RseI CAYNNNNRTG 2 cut(s) 38, 162
SaqAI TTAA 2 cut(s) 125, 172
SatI GCNGC 2 cut(s) 14, 31
Sau3AI GATC 4 cut(s) 66, 81, 87, 213
SduI GDGCHC 1 cut(s) 204
SetI ASST 1 cut(s) 114
SfaNI GCATC 1 cut(s) 30
SfcI CTRYAG 2 cut(s) 14, 148
SgeI CNNG 8 cut(s) 29, 58, 66, 97, 103, 121, 190, 205
SmiMI CAYNNNNRTG 2 cut(s) 38, 162
SmlI CTYRAG 1 cut(s) 124
SmoI CTYRAG 1 cut(s) 124
Sse9I AATT 2 cut(s) 116, 139
TaaI ACNGT 2 cut(s) 37, 199
TasI AATT 2 cut(s) 116, 139
Tru1I TTAA 2 cut(s) 125, 172
Tru9I TTAA 2 cut(s) 125, 172
TscAI CASTG 3 cut(s) 42, 152, 204
TseI GCWGC 2 cut(s) 13, 30
TspRI CASTG 3 cut(s) 42, 152, 204
Vha464I CTTAAG 1 cut(s) 124
XceI RCATGY 1 cut(s) 57
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.