Rh7BG385300

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7B
Physical Location & Seq
Reverse (-)
41679538 .. 41680060
523 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7BG385300.1

Sequence Viewer

Length: 255 bp
ATGGGAAATGTTGATGCAGTTGTGGTGATGCCTCAGACTAATATTAAGGGTAGCAAGAGGTTTGTGAAAATGCTTGAGGAAAAGGAAACAGTGGTGAAACCTCTTGTTGTGGAGGTGAAATCTGAATCGTTGGAGCCTGTTGCAGGGGATCTTGAGGTGGTGGAGAAACCTAATTCTTCAAAGGAAGAGATGGAAGAGGCTGTTGATGTGAAAGATTCAATGGAGGAAGTGGTGGATGATTGCCAGGTGGTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

84

Amino Acids

9.28

Weight (kDa)

4.34

Isoelectric Point (pI)

44.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 156
AfiI CCNNNNNNNGG 1 cut(s) 143
AgsI TTSAA 2 cut(s) 180, 219
AjnI CCWGG 1 cut(s) 243
AlwI GGATC 1 cut(s) 156
AsuHPI GGTGA 3 cut(s) 37, 106, 127
BccI CCATC 1 cut(s) 184
BciT130I CCWGG 1 cut(s) 245
Bme1390I CCNGG 1 cut(s) 245
BmiI GGNNCC 1 cut(s) 135
BmrFI CCNGG 1 cut(s) 245
BmsI GCATC 2 cut(s) 4, 18
BpuEI CTTGAG 2 cut(s) 95, 173
Bsc4I CCNNNNNNNGG 1 cut(s) 143
BseBI CCWGG 1 cut(s) 245
BseGI GGATG 1 cut(s) 241
BseLI CCNNNNNNNGG 1 cut(s) 143
BseMII CTCAG 1 cut(s) 47
BslI CCNNNNNNNGG 1 cut(s) 143
Bsp143I GATC 1 cut(s) 148
BspCNI CTCAG 1 cut(s) 46
BspLI GGNNCC 1 cut(s) 135
BspPI GGATC 1 cut(s) 156
BssMI GATC 1 cut(s) 148
Bst2UI CCWGG 1 cut(s) 245
Bst4CI ACNGT 1 cut(s) 91
Bst6I CTCTTC 2 cut(s) 180, 189
BstDEI CTNAG 1 cut(s) 33
BstENI CCTNNNNNAGG 1 cut(s) 141
BstF5I GGATG 1 cut(s) 241
BstKTI GATC 1 cut(s) 151
BstMBI GATC 1 cut(s) 148
BstNI CCWGG 1 cut(s) 245
BstSCI CCNGG 1 cut(s) 243
BstX2I RGATCY 1 cut(s) 148
BstYI RGATCY 1 cut(s) 148
BtsCI GGATG 1 cut(s) 241
BtsIMutI CAGTG 1 cut(s) 96
CviJI RGCY 2 cut(s) 136, 200
CviKI_1 RGCY 2 cut(s) 136, 200
DdeI CTNAG 1 cut(s) 33
DpnI GATC 1 cut(s) 150
DpnII GATC 1 cut(s) 148
Eam1104I CTCTTC 2 cut(s) 180, 189
EarI CTCTTC 2 cut(s) 180, 189
EcoNI CCTNNNNNAGG 1 cut(s) 141
EcoRII CCWGG 1 cut(s) 243
FokI GGATG 1 cut(s) 248
HinfI GANTC 2 cut(s) 125, 215
HphI GGTGA 3 cut(s) 37, 106, 127
Hpy188I TCNGA 2 cut(s) 36, 124
Hpy188III TCNNGA 1 cut(s) 152
HpyCH4III ACNGT 1 cut(s) 91
HpyCH4V TGCA 2 cut(s) 17, 143
HpyF3I CTNAG 1 cut(s) 33
Kzo9I GATC 1 cut(s) 148
LmnI GCTCC 1 cut(s) 133
LpnPI CCDG 3 cut(s) 129, 150, 230
LweI GCATC 2 cut(s) 4, 18
MalI GATC 1 cut(s) 150
MboI GATC 1 cut(s) 148
MboII GAAGA 3 cut(s) 168, 197, 206
MflI RGATCY 1 cut(s) 148
MluCI AATT 1 cut(s) 172
MmeI TCCRAC 1 cut(s) 111
MnlI CCTC 8 cut(s) 42, 51, 70, 106, 111, 148, 190, 217
MseI TTAA 2 cut(s) 45, 253
MspR9I CCNGG 1 cut(s) 245
MvaI CCWGG 1 cut(s) 245
NdeII GATC 1 cut(s) 148
NlaIV GGNNCC 1 cut(s) 135
PfeI GAWTC 2 cut(s) 125, 215
Psp6I CCWGG 1 cut(s) 243
PspGI CCWGG 1 cut(s) 243
PspN4I GGNNCC 1 cut(s) 135
PsuI RGATCY 1 cut(s) 148
SaqAI TTAA 2 cut(s) 45, 253
Sau3AI GATC 1 cut(s) 148
ScrFI CCNGG 1 cut(s) 245
SetI ASST 6 cut(s) 62, 103, 117, 159, 172, 249
SfaNI GCATC 2 cut(s) 4, 18
SgeI CNNG 6 cut(s) 67, 86, 116, 149, 156, 164
SmlI CTYRAG 2 cut(s) 74, 152
SmoI CTYRAG 2 cut(s) 74, 152
Sse9I AATT 1 cut(s) 172
SspI AATATT 1 cut(s) 43
StyD4I CCNGG 1 cut(s) 243
TaaI ACNGT 1 cut(s) 91
TasI AATT 1 cut(s) 172
TfiI GAWTC 2 cut(s) 125, 215
Tru1I TTAA 2 cut(s) 45, 253
Tru9I TTAA 2 cut(s) 45, 253
TscAI CASTG 1 cut(s) 96
TspRI CASTG 1 cut(s) 96
XagI CCTNNNNNAGG 1 cut(s) 141
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.