Rmu_sc0004761.1_g000012

QWRF motif-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004761.1
Physical Location & Seq
Forward (+)
54334 .. 54778
445 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004761.1_g000012.1.cds

Sequence Viewer

Length: 360 bp
atgttggttatggaccgggattactctaattccttgtccggtgccatcgaagctttgagggctagcacactccgccttctagtggttgatggagcaagggcagatgtccacaatgtgaaggatgctatttcttccgcagttgatgtgatgcaggcaatggcatcatcaatatgcttattattatcgaaggtgatttttctcaaactttatggtactggccaagtcaattgccaagtcgctgtcaattacatgtcattggataggccacgttgcatgttactaatcaagtcactgcctatgtcactagccaacaacgtaactggccagcccaggtccctaattagtgagggtactggctaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

119

Amino Acids

12.77

Weight (kDa)

8.55

Isoelectric Point (pI)

30.01

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 41
AciI CCGC 2 cut(s) 73, 135
AcoI YGGCCR 2 cut(s) 217, 322
AdeI CACNNNGTG 1 cut(s) 115
AfaI GTAC 2 cut(s) 214, 352
AfiI CCNNNNNNNGG 1 cut(s) 82
AflIII ACRYGT 1 cut(s) 249
AjnI CCWGG 1 cut(s) 329
AluBI AGCT 1 cut(s) 53
AluI AGCT 1 cut(s) 53
AoxI GGCC 3 cut(s) 217, 263, 322
AspS9I GGNCC 2 cut(s) 13, 333
AsuC2I CCSGG 1 cut(s) 17
AsuHPI GGTGA 1 cut(s) 202
AsuNHI GCTAGC 1 cut(s) 62
AvaII GGWCC 2 cut(s) 13, 333
BalI TGGCCA 2 cut(s) 219, 324
BanI GGYRCC 1 cut(s) 41
BccI CCATC 2 cut(s) 53, 83
BciT130I CCWGG 1 cut(s) 331
BcnI CCSGG 1 cut(s) 17
BfaI CTAG 3 cut(s) 63, 80, 305
Bme1390I CCNGG 2 cut(s) 17, 331
Bme18I GGWCC 2 cut(s) 13, 333
BmgT120I GGNCC 2 cut(s) 13, 333
BmiI GGNNCC 2 cut(s) 43, 335
BmrFI CCNGG 2 cut(s) 17, 331
BmsI GCATC 3 cut(s) 112, 138, 170
BmtI GCTAGC 1 cut(s) 66
BpuMI CCSGG 1 cut(s) 17
BsaJI CCNNGG 1 cut(s) 329
BsaWI WCCGGW 1 cut(s) 38
Bsc4I CCNNNNNNNGG 1 cut(s) 82
Bse1I ACTGG 3 cut(s) 220, 325, 358
Bse3DI GCAATG 1 cut(s) 162
BseBI CCWGG 1 cut(s) 331
BseDI CCNNGG 1 cut(s) 329
BseGI GGATG 1 cut(s) 127
BseLI CCNNNNNNNGG 1 cut(s) 82
BseMI GCAATG 1 cut(s) 162
BseNI ACTGG 3 cut(s) 220, 325, 358
BshFI GGCC 3 cut(s) 219, 265, 324
BshNI GGYRCC 1 cut(s) 41
BsiSI CCGG 2 cut(s) 16, 39
BslFI GGGAC 1 cut(s) 319
BslI CCNNNNNNNGG 1 cut(s) 82
BsmFI GGGAC 1 cut(s) 319
BsnI GGCC 3 cut(s) 219, 265, 324
BspACI CCGC 2 cut(s) 73, 135
BspANI GGCC 3 cut(s) 219, 265, 324
BspLI GGNNCC 2 cut(s) 43, 335
BspOI GCTAGC 1 cut(s) 66
BspT107I GGYRCC 1 cut(s) 41
BsrDI GCAATG 1 cut(s) 162
BsrI ACTGG 3 cut(s) 220, 325, 358
BssECI CCNNGG 1 cut(s) 329
Bst2UI CCWGG 1 cut(s) 331
BstC8I GCNNGC 3 cut(s) 64, 153, 326
BstF5I GGATG 1 cut(s) 127
BstMWI GCNNNNNNNGC 3 cut(s) 50, 59, 72
BstNI CCWGG 1 cut(s) 331
BstNSI RCATGY 2 cut(s) 253, 277
BstSCI CCNGG 2 cut(s) 15, 329
BsuRI GGCC 3 cut(s) 219, 265, 324
BtsCI GGATG 1 cut(s) 127
BtsI GCAGTG 1 cut(s) 290
BtsIMutI CAGTG 1 cut(s) 290
Cac8I GCNNGC 3 cut(s) 64, 153, 326
Cfr13I GGNCC 2 cut(s) 13, 333
Csp6I GTAC 2 cut(s) 213, 351
CviAII CATG 2 cut(s) 250, 274
CviJI RGCY 8 cut(s) 53, 62, 219, 265, 308, 324, 328, 357
CviKI_1 RGCY 8 cut(s) 53, 62, 219, 265, 308, 324, 328, 357
CviQI GTAC 2 cut(s) 213, 351
DraIII CACNNNGTG 1 cut(s) 115
EaeI YGGCCR 2 cut(s) 217, 322
EciI GGCGGA 1 cut(s) 62
Eco47I GGWCC 2 cut(s) 13, 333
EcoO109I RGGNCCY 1 cut(s) 333
EcoRII CCWGG 1 cut(s) 329
FaeI CATG 2 cut(s) 253, 277
FaiI YATR 6 cut(s) 11, 172, 210, 251, 275, 299
FaqI GGGAC 1 cut(s) 319
FatI CATG 2 cut(s) 249, 273
FokI GGATG 1 cut(s) 134
FspBI CTAG 3 cut(s) 63, 80, 305
HaeIII GGCC 3 cut(s) 219, 265, 324
HapII CCGG 2 cut(s) 16, 39
Hin1II CATG 2 cut(s) 253, 277
HindIII AAGCTT 1 cut(s) 51
HpaII CCGG 2 cut(s) 16, 39
HphI GGTGA 1 cut(s) 202
Hpy166II GTNNAC 1 cut(s) 109
Hpy8I GTNNAC 1 cut(s) 109
HpyAV CCTTC 3 cut(s) 86, 112, 181
HpyCH4IV ACGT 2 cut(s) 268, 315
HpyCH4V TGCA 2 cut(s) 151, 273
HpyF10VI GCNNNNNNNGC 3 cut(s) 50, 59, 72
HpySE526I ACGT 2 cut(s) 268, 315
Hsp92II CATG 2 cut(s) 253, 277
LmnI GCTCC 1 cut(s) 92
LpnPI CCDG 9 cut(s) 29, 52, 137, 201, 306, 316, 338, 339, 343
LweI GCATC 3 cut(s) 112, 138, 170
MaeI CTAG 3 cut(s) 63, 80, 305
MaeII ACGT 2 cut(s) 268, 315
MaeIII GTNAC 4 cut(s) 276, 288, 300, 316
MboII GAAGA 1 cut(s) 123
MfeI CAATTG 1 cut(s) 226
MlsI TGGCCA 2 cut(s) 219, 324
MluCI AATT 4 cut(s) 28, 226, 244, 339
MluNI TGGCCA 2 cut(s) 219, 324
MnlI CCTC 2 cut(s) 51, 340
Mox20I TGGCCA 2 cut(s) 219, 324
MscI TGGCCA 2 cut(s) 219, 324
MslI CAYNNNNRTG 1 cut(s) 169
Msp20I TGGCCA 2 cut(s) 219, 324
MspI CCGG 2 cut(s) 16, 39
MspR9I CCNGG 2 cut(s) 17, 331
MunI CAATTG 1 cut(s) 226
MvaI CCWGG 1 cut(s) 331
MwoI GCNNNNNNNGC 3 cut(s) 50, 59, 72
NciI CCSGG 1 cut(s) 17
NheI GCTAGC 1 cut(s) 62
NlaIII CATG 2 cut(s) 253, 277
NlaIV GGNNCC 2 cut(s) 43, 335
NmuCI GTSAC 2 cut(s) 288, 300
NspI RCATGY 2 cut(s) 253, 277
PciI ACATGT 1 cut(s) 249
PpuMI RGGWCCY 1 cut(s) 333
PscI ACATGT 1 cut(s) 249
Psp5II RGGWCCY 1 cut(s) 333
Psp6I CCWGG 1 cut(s) 329
PspGI CCWGG 1 cut(s) 329
PspN4I GGNNCC 2 cut(s) 43, 335
PspPI GGNCC 2 cut(s) 13, 333
PspPPI RGGWCCY 1 cut(s) 333
RsaI GTAC 2 cut(s) 214, 352
RsaNI GTAC 2 cut(s) 213, 351
RseI CAYNNNNRTG 1 cut(s) 169
Sau96I GGNCC 2 cut(s) 13, 333
ScrFI CCNGG 2 cut(s) 17, 331
SetI ASST 5 cut(s) 55, 192, 271, 318, 335
SfaNI GCATC 3 cut(s) 112, 138, 170
SinI GGWCC 2 cut(s) 13, 333
SmiMI CAYNNNNRTG 1 cut(s) 169
Sse9I AATT 4 cut(s) 28, 226, 244, 339
SsiI CCGC 2 cut(s) 73, 135
SspMI CTAG 3 cut(s) 63, 80, 305
StyD4I CCNGG 2 cut(s) 15, 329
TaiI ACGT 2 cut(s) 271, 318
TaqI TCGA 2 cut(s) 48, 185
TasI AATT 4 cut(s) 28, 226, 244, 339
TscAI CASTG 1 cut(s) 297
TseFI GTSAC 2 cut(s) 288, 300
Tsp45I GTSAC 2 cut(s) 288, 300
TspRI CASTG 1 cut(s) 297
VpaK11BI GGWCC 2 cut(s) 13, 333
XceI RCATGY 2 cut(s) 253, 277
XspI CTAG 3 cut(s) 63, 80, 305
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.