Rh5CG247500

QWRF motif-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
OG0001505
Physical Location & Seq
Reverse (-)
26060446 .. 26060625
180 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG247500.1

Sequence Viewer

Length: 180 bp
ATGTCGGCGAGGCCGGATCAGAGTGAGAATTCCAAGCCGATGGAGCAGTATCGGTGGCCGATGAGGTTGAGGCCGGACACTTGTATGACCAGGAGCTTGGATTGTACGGTGGAGAGGAAGAAAGTGAATGGAACTGGCTCCAATGTGGTTAGGGACATTACAAAATTCACTGGGGAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
QWRF

Protein Analysis

59

Amino Acids

6.84

Weight (kDa)

9.23

Isoelectric Point (pI)

44.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 24
AcoI YGGCCR 1 cut(s) 56
AcsI RAATTY 2 cut(s) 28, 164
AfaI GTAC 1 cut(s) 106
AjnI CCWGG 1 cut(s) 89
AluBI AGCT 1 cut(s) 96
AluI AGCT 1 cut(s) 96
AlwI GGATC 1 cut(s) 24
AoxI GGCC 3 cut(s) 11, 56, 71
ApoI RAATTY 2 cut(s) 28, 164
BccI CCATC 1 cut(s) 34
BciT130I CCWGG 1 cut(s) 91
Bme1390I CCNGG 1 cut(s) 91
BmiI GGNNCC 1 cut(s) 139
BmrFI CCNGG 1 cut(s) 91
BmrI ACTGGG 1 cut(s) 180
BmuI ACTGGG 1 cut(s) 180
Bse1I ACTGG 2 cut(s) 139, 175
BseBI CCWGG 1 cut(s) 91
BseNI ACTGG 2 cut(s) 139, 175
BshFI GGCC 3 cut(s) 13, 58, 73
BsiSI CCGG 2 cut(s) 14, 74
BslFI GGGAC 1 cut(s) 167
BsmFI GGGAC 1 cut(s) 167
BsnI GGCC 3 cut(s) 13, 58, 73
Bsp143I GATC 1 cut(s) 16
BspANI GGCC 3 cut(s) 13, 58, 73
BspLI GGNNCC 1 cut(s) 139
BspPI GGATC 1 cut(s) 24
BsrI ACTGG 2 cut(s) 139, 175
BssMI GATC 1 cut(s) 16
Bst2UI CCWGG 1 cut(s) 91
Bst4CI ACNGT 1 cut(s) 109
BstKTI GATC 1 cut(s) 19
BstMBI GATC 1 cut(s) 16
BstMWI GCNNNNNNNGC 1 cut(s) 43
BstNI CCWGG 1 cut(s) 91
BstSCI CCNGG 1 cut(s) 89
BstXI CCANNNNNNTGG 2 cut(s) 40, 97
BsuRI GGCC 3 cut(s) 13, 58, 73
BtsIMutI CAGTG 1 cut(s) 168
Csp6I GTAC 1 cut(s) 105
CviJI RGCY 6 cut(s) 13, 37, 58, 73, 96, 138
CviKI_1 RGCY 6 cut(s) 13, 37, 58, 73, 96, 138
CviQI GTAC 1 cut(s) 105
DpnI GATC 1 cut(s) 18
DpnII GATC 1 cut(s) 16
EaeI YGGCCR 1 cut(s) 56
EcoRI GAATTC 1 cut(s) 28
EcoRII CCWGG 1 cut(s) 89
FaiI YATR 1 cut(s) 86
FaqI GGGAC 1 cut(s) 167
HaeIII GGCC 3 cut(s) 13, 58, 73
HapII CCGG 2 cut(s) 14, 74
HpaII CCGG 2 cut(s) 14, 74
Hpy188I TCNGA 1 cut(s) 21
HpyCH4III ACNGT 1 cut(s) 109
HpyF10VI GCNNNNNNNGC 1 cut(s) 43
Kzo9I GATC 1 cut(s) 16
LmnI GCTCC 3 cut(s) 43, 93, 143
LpnPI CCDG 6 cut(s) 27, 76, 87, 103, 120, 156
MalI GATC 1 cut(s) 18
MboI GATC 1 cut(s) 16
MboII GAAGA 1 cut(s) 130
MluCI AATT 2 cut(s) 28, 164
MnlI CCTC 4 cut(s) 3, 57, 63, 108
MslI CAYNNNNRTG 1 cut(s) 83
MspI CCGG 2 cut(s) 14, 74
MspR9I CCNGG 1 cut(s) 91
MvaI CCWGG 1 cut(s) 91
MwoI GCNNNNNNNGC 1 cut(s) 43
NdeII GATC 1 cut(s) 16
NlaIV GGNNCC 1 cut(s) 139
Psp6I CCWGG 1 cut(s) 89
PspGI CCWGG 1 cut(s) 89
PspN4I GGNNCC 1 cut(s) 139
RsaI GTAC 1 cut(s) 106
RsaNI GTAC 1 cut(s) 105
RseI CAYNNNNRTG 1 cut(s) 83
Sau3AI GATC 1 cut(s) 16
ScrFI CCNGG 1 cut(s) 91
SetI ASST 2 cut(s) 68, 98
SgeI CNNG 9 cut(s) 21, 26, 46, 86, 93, 102, 103, 109, 147
SmiMI CAYNNNNRTG 1 cut(s) 83
Sse9I AATT 2 cut(s) 28, 164
StyD4I CCNGG 1 cut(s) 89
TaaI ACNGT 1 cut(s) 109
TasI AATT 2 cut(s) 28, 164
TscAI CASTG 1 cut(s) 175
TspRI CASTG 1 cut(s) 175
XapI RAATTY 2 cut(s) 28, 164
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.