Rh4BG047100

QWRF motif-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4B
OG0001505
Physical Location & Seq
Forward (+)
8570336 .. 8570572
237 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4BG047100.1

Sequence Viewer

Length: 237 bp
ATGAGTAAAGCGAAGCGAGCGCCATCTCCAACTGCGAGGAAAGGCAATCCAGAGCTGAGGAAGGCTTCAACATCGGCGAGGCGGGATCAGAGCGAGAATTCTAGGTCGATGGAGCAGTACCAGTGGCCAGAGAGGTTGAGGCCGAACACTTGTATTACCAGGAGCTTGGATTATATGGTGGAGAGGAAGAAAGTGAATGGATCTGCCTCCAATGTGGCTAGGGAATTACAAAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
QWRF

Protein Analysis

78

Amino Acids

8.95

Weight (kDa)

10.65

Isoelectric Point (pI)

75.97

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 82
AclWI GGATC 2 cut(s) 93, 208
AcoI YGGCCR 1 cut(s) 125
AcsI RAATTY 1 cut(s) 97
AfaI GTAC 1 cut(s) 119
AgsI TTSAA 1 cut(s) 69
AjnI CCWGG 1 cut(s) 158
AluBI AGCT 2 cut(s) 55, 165
AluI AGCT 2 cut(s) 55, 165
AlwI GGATC 2 cut(s) 93, 208
AoxI GGCC 2 cut(s) 125, 140
ApoI RAATTY 1 cut(s) 97
AspLEI GCGC 1 cut(s) 22
BalI TGGCCA 1 cut(s) 127
BbvCI CCTCAGC 1 cut(s) 56
BccI CCATC 2 cut(s) 31, 103
BciT130I CCWGG 1 cut(s) 160
BfaI CTAG 2 cut(s) 102, 219
BfoI RGCGCY 1 cut(s) 23
Bme1390I CCNGG 1 cut(s) 160
BmrFI CCNGG 1 cut(s) 160
Bpu10I CCTNAGC 1 cut(s) 56
Bse1I ACTGG 1 cut(s) 121
BseBI CCWGG 1 cut(s) 160
BseMII CTCAG 1 cut(s) 47
BseNI ACTGG 1 cut(s) 121
BshFI GGCC 2 cut(s) 127, 142
BsnI GGCC 2 cut(s) 127, 142
Bsp143I GATC 2 cut(s) 85, 200
BspACI CCGC 1 cut(s) 82
BspANI GGCC 2 cut(s) 127, 142
BspCNI CTCAG 1 cut(s) 48
BspPI GGATC 2 cut(s) 93, 208
BsrI ACTGG 1 cut(s) 121
BssMI GATC 2 cut(s) 85, 200
Bst2UI CCWGG 1 cut(s) 160
BstC8I GCNNGC 1 cut(s) 18
BstDEI CTNAG 1 cut(s) 56
BstH2I RGCGCY 1 cut(s) 23
BstHHI GCGC 1 cut(s) 22
BstKTI GATC 2 cut(s) 88, 203
BstMBI GATC 2 cut(s) 85, 200
BstMWI GCNNNNNNNGC 1 cut(s) 17
BstNI CCWGG 1 cut(s) 160
BstSCI CCNGG 1 cut(s) 158
BstX2I RGATCY 1 cut(s) 200
BstXI CCANNNNNNTGG 1 cut(s) 166
BstYI RGATCY 1 cut(s) 200
BsuRI GGCC 2 cut(s) 127, 142
BtsIMutI CAGTG 1 cut(s) 128
Cac8I GCNNGC 1 cut(s) 18
CfoI GCGC 1 cut(s) 22
Csp6I GTAC 1 cut(s) 118
CviJI RGCY 6 cut(s) 55, 65, 127, 142, 165, 218
CviKI_1 RGCY 6 cut(s) 55, 65, 127, 142, 165, 218
CviQI GTAC 1 cut(s) 118
DdeI CTNAG 1 cut(s) 56
DpnI GATC 2 cut(s) 87, 202
DpnII GATC 2 cut(s) 85, 200
EaeI YGGCCR 1 cut(s) 125
EcoRI GAATTC 1 cut(s) 97
EcoRII CCWGG 1 cut(s) 158
FaiI YATR 2 cut(s) 174, 176
FauI CCCGC 1 cut(s) 75
FspBI CTAG 2 cut(s) 102, 219
GlaI GCGC 1 cut(s) 21
HaeII RGCGCY 1 cut(s) 23
HaeIII GGCC 2 cut(s) 127, 142
HhaI GCGC 1 cut(s) 22
Hin6I GCGC 1 cut(s) 20
HinP1I GCGC 1 cut(s) 20
Hpy188I TCNGA 1 cut(s) 90
Hpy188III TCNNGA 1 cut(s) 50
HpyAV CCTTC 1 cut(s) 55
HpyF10VI GCNNNNNNNGC 1 cut(s) 17
HpyF3I CTNAG 1 cut(s) 56
HspAI GCGC 1 cut(s) 20
Kzo9I GATC 2 cut(s) 85, 200
LmnI GCTCC 2 cut(s) 112, 162
LpnPI CCDG 5 cut(s) 63, 134, 141, 145, 172
MaeI CTAG 2 cut(s) 102, 219
MalI GATC 2 cut(s) 87, 202
MboI GATC 2 cut(s) 85, 200
MboII GAAGA 1 cut(s) 199
MflI RGATCY 1 cut(s) 200
MlsI TGGCCA 1 cut(s) 127
MluCI AATT 3 cut(s) 97, 224, 232
MluNI TGGCCA 1 cut(s) 127
MmeI TCCRAC 1 cut(s) 53
MnlI CCTC 7 cut(s) 30, 51, 72, 126, 132, 177, 217
Mox20I TGGCCA 1 cut(s) 127
MscI TGGCCA 1 cut(s) 127
MseI TTAA 1 cut(s) 235
Msp20I TGGCCA 1 cut(s) 127
MspR9I CCNGG 1 cut(s) 160
MvaI CCWGG 1 cut(s) 160
MwoI GCNNNNNNNGC 1 cut(s) 17
NdeII GATC 2 cut(s) 85, 200
Psp6I CCWGG 1 cut(s) 158
PspGI CCWGG 1 cut(s) 158
PsuI RGATCY 1 cut(s) 200
RsaI GTAC 1 cut(s) 119
RsaNI GTAC 1 cut(s) 118
SaqAI TTAA 1 cut(s) 235
Sau3AI GATC 2 cut(s) 85, 200
ScrFI CCNGG 1 cut(s) 160
SetI ASST 4 cut(s) 57, 107, 137, 167
Sse9I AATT 3 cut(s) 97, 224, 232
SsiI CCGC 1 cut(s) 82
SspMI CTAG 2 cut(s) 102, 219
StyD4I CCNGG 1 cut(s) 158
TaqI TCGA 1 cut(s) 107
TasI AATT 3 cut(s) 97, 224, 232
Tru1I TTAA 1 cut(s) 235
Tru9I TTAA 1 cut(s) 235
TscAI CASTG 1 cut(s) 128
TspRI CASTG 1 cut(s) 128
XapI RAATTY 1 cut(s) 97
XspI CTAG 2 cut(s) 102, 219
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.