Rmu_sc0005898.1_g000016

rRNA processing

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005898.1
Physical Location & Seq
Forward (+)
51917 .. 54675
2759 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005898.1_g000016.1.cds

Sequence Viewer

Length: 870 bp
atggtgggtttcgctgaagactaccacttgaggagcaggagaaatatcttggacggcagaaaagaattgaacactccttacagggacgttgtggaagcctgcattgtaagaaatgtgaagcctgcaactctgttcaggttgatgaactttagtcatcaattgggtggacagtcggacaatcttgagatggatgtattagggtttgaaacagtaacgaaaagaaaacggacggaggagaagagaaagaatgatgttcatgttgtcatgtccgagccaacagcagctgcgatggaggggcagcatggagaatcgtcggatccattggacaaagccctgttcggcccttcgttgaacaaagctggcatgctcgtctgtggtgccttcttctctgaaaagcgagccaaagtattggaagaagaatggcccattgtggaatcatccttggaacagtatggcatttcatgcacaatttatctggatgagggtttcatgacattctcaacaactaaggatcgagatactatttacaaggctagagatgttcttgaacttctgtcatcgacttctgttaagccctcactggcaatagaagtactgaatggcaggctgaagcatgatatcatcaagactgggtattttaatggtgggattggttcagaattgaagattgataaggagacgttcgttaagcagactggacttttcaaagcctctttacaggatgttgctgatgtgtcgcattgttatatttataccaatgcaagttacctcccttttgtgattcggaggtttggcattcctgatcgtagcagctctgatgaagttggaattttgaatctgataatatctaatttacgtgttaatgaatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

289

Amino Acids

32.49

Weight (kDa)

5.95

Isoelectric Point (pI)

43.18

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 377
AclWI GGATC 3 cut(s) 311, 324, 519
AcsI RAATTY 1 cut(s) 828
AcuI CTGAAG 2 cut(s) 36, 629
AfaI GTAC 1 cut(s) 594
AflIII ACRYGT 1 cut(s) 856
AgsI TTSAA 7 cut(s) 70, 206, 352, 548, 664, 706, 835
AluBI AGCT 3 cut(s) 284, 359, 813
AluI AGCT 3 cut(s) 284, 359, 813
Alw26I GTCTC 1 cut(s) 671
AlwI GGATC 3 cut(s) 311, 324, 519
AlwNI CAGNNNCTG 1 cut(s) 284
AoxI GGCC 2 cut(s) 340, 422
ApeKI GCWGC 4 cut(s) 281, 284, 298, 810
ApoI RAATTY 1 cut(s) 828
AspS9I GGNCC 2 cut(s) 341, 423
BamHI GGATCC 1 cut(s) 316
BanI GGYRCC 1 cut(s) 377
BbsI GAAGAC 1 cut(s) 24
BbvI GCAGC 4 cut(s) 271, 293, 310, 822
BccI CCATC 2 cut(s) 181, 283
BceAI ACGGC 1 cut(s) 70
BcoDI GTCTC 1 cut(s) 671
BfaI CTAG 1 cut(s) 534
BisI GCNGC 4 cut(s) 282, 285, 299, 811
BlsI GCNGC 4 cut(s) 283, 286, 300, 812
BmcAI AGTACT 1 cut(s) 594
BmgT120I GGNCC 2 cut(s) 341, 423
BmiI GGNNCC 2 cut(s) 318, 379
BmrI ACTGGG 1 cut(s) 639
BmuI ACTGGG 1 cut(s) 639
BpiI GAAGAC 1 cut(s) 24
BpuEI CTTGAG 2 cut(s) 49, 203
BsaAI YACGTR 1 cut(s) 857
BsaJI CCNNGG 1 cut(s) 441
Bse1I ACTGG 3 cut(s) 585, 634, 700
BseDI CCNNGG 1 cut(s) 441
BseGI GGATG 4 cut(s) 196, 437, 484, 727
BseNI ACTGG 3 cut(s) 585, 634, 700
BseRI GAGGAG 2 cut(s) 46, 248
BseXI GCAGC 4 cut(s) 271, 293, 310, 822
BshFI GGCC 2 cut(s) 342, 424
BshNI GGYRCC 1 cut(s) 377
BslFI GGGAC 1 cut(s) 98
BsmAI GTCTC 1 cut(s) 671
BsmBI CGTCTC 1 cut(s) 671
BsmFI GGGAC 1 cut(s) 98
BsmI GAATGC 1 cut(s) 795
BsnI GGCC 2 cut(s) 342, 424
Bsp143I GATC 3 cut(s) 316, 511, 802
BspANI GGCC 2 cut(s) 342, 424
BspHI TCATGA 1 cut(s) 489
BspLI GGNNCC 2 cut(s) 318, 379
BspPI GGATC 3 cut(s) 311, 324, 519
BspT107I GGYRCC 1 cut(s) 377
BsrI ACTGG 3 cut(s) 585, 634, 700
BssECI CCNNGG 1 cut(s) 441
BssMI GATC 3 cut(s) 316, 511, 802
BssT1I CCWWGG 1 cut(s) 441
Bst4CI ACNGT 3 cut(s) 171, 211, 450
Bst6I CTCTTC 1 cut(s) 233
BstAPI GCANNNNNTGC 1 cut(s) 462
BstBAI YACGTR 1 cut(s) 857
BstC8I GCNNGC 6 cut(s) 100, 123, 361, 365, 399, 605
BstDEI CTNAG 1 cut(s) 507
BstF5I GGATG 4 cut(s) 196, 437, 484, 727
BstKTI GATC 3 cut(s) 319, 514, 805
BstMAI GTCTC 1 cut(s) 671
BstMBI GATC 3 cut(s) 316, 511, 802
BstMWI GCNNNNNNNGC 1 cut(s) 462
BstNSI RCATGY 1 cut(s) 367
BstV1I GCAGC 4 cut(s) 271, 293, 310, 822
BstV2I GAAGAC 1 cut(s) 24
BstX2I RGATCY 1 cut(s) 316
BstXI CCANNNNNNTGG 1 cut(s) 409
BstYI RGATCY 1 cut(s) 316
BsuRI GGCC 2 cut(s) 342, 424
BtgZI GCGATG 1 cut(s) 302
BtsCI GGATG 4 cut(s) 196, 437, 484, 727
BtsIMutI CAGTG 1 cut(s) 578
Cac8I GCNNGC 6 cut(s) 100, 123, 361, 365, 399, 605
CaiI CAGNNNCTG 1 cut(s) 284
CciI TCATGA 1 cut(s) 489
Cfr13I GGNCC 2 cut(s) 341, 423
Csp6I GTAC 1 cut(s) 593
CviAII CATG 7 cut(s) 257, 265, 302, 364, 462, 490, 614
CviQI GTAC 1 cut(s) 593
DdeI CTNAG 1 cut(s) 507
DpnI GATC 3 cut(s) 318, 513, 804
DpnII GATC 3 cut(s) 316, 511, 802
Eam1104I CTCTTC 1 cut(s) 233
EarI CTCTTC 1 cut(s) 233
Eco130I CCWWGG 1 cut(s) 441
Eco32I GATATC 1 cut(s) 619
Eco57I CTGAAG 2 cut(s) 36, 629
EcoRV GATATC 1 cut(s) 619
EcoT14I CCWWGG 1 cut(s) 441
ErhI CCWWGG 1 cut(s) 441
Esp3I CGTCTC 1 cut(s) 671
FaeI CATG 7 cut(s) 260, 268, 305, 367, 465, 493, 617
FaqI GGGAC 1 cut(s) 98
FatI CATG 7 cut(s) 256, 264, 301, 363, 461, 489, 613
Fnu4HI GCNGC 4 cut(s) 282, 285, 299, 811
FokI GGATG 4 cut(s) 203, 424, 491, 734
Fsp4HI GCNGC 4 cut(s) 282, 285, 299, 811
FspBI CTAG 1 cut(s) 534
GluI GCNGC 4 cut(s) 282, 285, 299, 811
HaeIII GGCC 2 cut(s) 342, 424
Hin1II CATG 7 cut(s) 260, 268, 305, 367, 465, 493, 617
HinfI GANTC 4 cut(s) 308, 434, 781, 835
Hpy166II GTNNAC 1 cut(s) 167
Hpy188I TCNGA 8 cut(s) 175, 271, 316, 391, 658, 786, 817, 840
Hpy188III TCNNGA 7 cut(s) 182, 476, 490, 515, 545, 625, 800
Hpy8I GTNNAC 1 cut(s) 167
Hpy99I CGWCG 1 cut(s) 316
HpyAV CCTTC 2 cut(s) 354, 391
HpyCH4III ACNGT 3 cut(s) 171, 211, 450
HpyCH4IV ACGT 3 cut(s) 87, 680, 856
HpyCH4V TGCA 4 cut(s) 102, 125, 465, 761
HpyF10VI GCNNNNNNNGC 1 cut(s) 462
HpyF3I CTNAG 1 cut(s) 507
HpySE526I ACGT 3 cut(s) 87, 680, 856
Hsp92II CATG 7 cut(s) 260, 268, 305, 367, 465, 493, 617
Kzo9I GATC 3 cut(s) 316, 511, 802
LmnI GCTCC 1 cut(s) 33
Lsp1109I GCAGC 4 cut(s) 271, 293, 310, 822
MaeI CTAG 1 cut(s) 534
MaeII ACGT 3 cut(s) 87, 680, 856
MaeIII GTNAC 2 cut(s) 211, 764
MalI GATC 3 cut(s) 318, 513, 804
MboI GATC 3 cut(s) 316, 511, 802
MboII GAAGA 6 cut(s) 29, 250, 376, 425, 428, 676
MfeI CAATTG 1 cut(s) 158
MflI RGATCY 1 cut(s) 316
MluCI AATT 6 cut(s) 65, 158, 468, 659, 828, 850
MmeI TCCRAC 3 cut(s) 153, 294, 805
MnlI CCTC 8 cut(s) 24, 226, 286, 475, 586, 721, 779, 780
MseI TTAA 4 cut(s) 570, 639, 687, 861
MspA1I CMGCKG 1 cut(s) 284
MunI CAATTG 1 cut(s) 158
Mva1269I GAATGC 1 cut(s) 795
MwoI GCNNNNNNNGC 1 cut(s) 462
NdeII GATC 3 cut(s) 316, 511, 802
NlaIII CATG 7 cut(s) 260, 268, 305, 367, 465, 493, 617
NlaIV GGNNCC 2 cut(s) 318, 379
NspI RCATGY 1 cut(s) 367
PaeI GCATGC 1 cut(s) 367
PagI TCATGA 1 cut(s) 489
PctI GAATGC 1 cut(s) 795
PfeI GAWTC 4 cut(s) 308, 434, 781, 835
PkrI GCNGC 4 cut(s) 283, 286, 300, 812
Ppu21I YACGTR 1 cut(s) 857
PspN4I GGNNCC 2 cut(s) 318, 379
PspPI GGNCC 2 cut(s) 341, 423
PsrI GAACNNNNNNTAC 2 cut(s) 62, 94
PstNI CAGNNNCTG 1 cut(s) 284
PsuI RGATCY 1 cut(s) 316
PvuII CAGCTG 1 cut(s) 284
RsaI GTAC 1 cut(s) 594
RsaNI GTAC 1 cut(s) 593
SaqAI TTAA 4 cut(s) 570, 639, 687, 861
SatI GCNGC 4 cut(s) 282, 285, 299, 811
Sau3AI GATC 3 cut(s) 316, 511, 802
Sau96I GGNCC 2 cut(s) 341, 423
ScaI AGTACT 1 cut(s) 594
SetI ASST 9 cut(s) 90, 140, 286, 361, 683, 771, 791, 815, 859
SmlI CTYRAG 2 cut(s) 28, 182
SmoI CTYRAG 2 cut(s) 28, 182
SphI GCATGC 1 cut(s) 367
Sse9I AATT 6 cut(s) 65, 158, 468, 659, 828, 850
SspMI CTAG 1 cut(s) 534
StyI CCWWGG 1 cut(s) 441
TaaI ACNGT 3 cut(s) 171, 211, 450
TaiI ACGT 3 cut(s) 90, 683, 859
TaqI TCGA 2 cut(s) 514, 560
TasI AATT 6 cut(s) 65, 158, 468, 659, 828, 850
TatI WGTACW 1 cut(s) 592
TfiI GAWTC 4 cut(s) 308, 434, 781, 835
Tru1I TTAA 4 cut(s) 570, 639, 687, 861
Tru9I TTAA 4 cut(s) 570, 639, 687, 861
TscAI CASTG 1 cut(s) 585
TseI GCWGC 4 cut(s) 281, 284, 298, 810
TspDTI ATGAA 5 cut(s) 158, 245, 450, 478, 834
TspGWI ACGGA 2 cut(s) 241, 245
TspRI CASTG 1 cut(s) 585
XapI RAATTY 1 cut(s) 828
XceI RCATGY 1 cut(s) 367
XspI CTAG 1 cut(s) 534
ZrmI AGTACT 1 cut(s) 594
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.