Rh7DG119900

rRNA processing

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
OG0003458
Physical Location & Seq
Forward (+)
10157487 .. 10158038
552 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG119900.1

Sequence Viewer

Length: 204 bp
ATGGTGGAATCTTCCTTAGAAAAGTATTGCATTTCATGCACACTTGATCAGGCTGAGCCTTCCATTACATTCTCAACCAGCTCAAGGACTAGGGGTCCAGATATTGTTAACAAGGCTAGGGATCTTCTTGAGCTTTTAACATTGACTGCGGTTCCATCATGCCAGATCCCGTGCCATACAAATACTGGATGGTGCAATGGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

67

Amino Acids

7.3

Weight (kDa)

5.05

Isoelectric Point (pI)

45.04

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
KH_KRR1_1st PF17903 2 - 47 3.1e-08 Krr1 KH1 domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 149
AclWI GGATC 2 cut(s) 129, 160
AfiI CCNNNNNNNGG 1 cut(s) 84
AhdI GACNNNNNGTC 1 cut(s) 93
AluBI AGCT 2 cut(s) 81, 133
AluI AGCT 2 cut(s) 81, 133
AlwI GGATC 2 cut(s) 129, 160
AspS9I GGNCC 1 cut(s) 95
AvaII GGWCC 1 cut(s) 95
BccI CCATC 2 cut(s) 163, 183
BclI TGATCA 1 cut(s) 46
BfaI CTAG 2 cut(s) 90, 117
BlpI GCTNAGC 1 cut(s) 54
Bme18I GGWCC 1 cut(s) 95
BmeRI GACNNNNNGTC 1 cut(s) 93
BmgT120I GGNCC 1 cut(s) 95
BmiI GGNNCC 2 cut(s) 96, 153
Bpu1102I GCTNAGC 1 cut(s) 54
BpuEI CTTGAG 2 cut(s) 67, 149
Bsc4I CCNNNNNNNGG 1 cut(s) 84
Bse1I ACTGG 1 cut(s) 190
Bse3DI GCAATG 1 cut(s) 202
BseGI GGATG 1 cut(s) 194
BseLI CCNNNNNNNGG 1 cut(s) 84
BseMI GCAATG 1 cut(s) 202
BseMII CTCAG 1 cut(s) 45
BseNI ACTGG 1 cut(s) 190
BslI CCNNNNNNNGG 1 cut(s) 84
Bsp143I GATC 3 cut(s) 46, 121, 165
Bsp1720I GCTNAGC 1 cut(s) 54
BspACI CCGC 1 cut(s) 149
BspCNI CTCAG 1 cut(s) 46
BspLI GGNNCC 2 cut(s) 96, 153
BspPI GGATC 2 cut(s) 129, 160
BsrDI GCAATG 1 cut(s) 202
BsrI ACTGG 1 cut(s) 190
BssMI GATC 3 cut(s) 46, 121, 165
BstAPI GCANNNNNTGC 1 cut(s) 36
BstDEI CTNAG 2 cut(s) 16, 54
BstF5I GGATG 1 cut(s) 194
BstKTI GATC 3 cut(s) 49, 124, 168
BstMBI GATC 3 cut(s) 46, 121, 165
BstMWI GCNNNNNNNGC 1 cut(s) 36
BstX2I RGATCY 2 cut(s) 121, 165
BstYI RGATCY 2 cut(s) 121, 165
BtsCI GGATG 1 cut(s) 194
Cfr13I GGNCC 1 cut(s) 95
CviAII CATG 2 cut(s) 36, 159
CviJI RGCY 6 cut(s) 53, 58, 81, 116, 133, 201
CviKI_1 RGCY 6 cut(s) 53, 58, 81, 116, 133, 201
DdeI CTNAG 2 cut(s) 16, 54
DpnI GATC 3 cut(s) 48, 123, 167
DpnII GATC 3 cut(s) 46, 121, 165
DriI GACNNNNNGTC 1 cut(s) 93
Eam1105I GACNNNNNGTC 1 cut(s) 93
Eco47I GGWCC 1 cut(s) 95
FaeI CATG 2 cut(s) 39, 162
FaiI YATR 3 cut(s) 37, 160, 177
FatI CATG 2 cut(s) 35, 158
FbaI TGATCA 1 cut(s) 46
FspBI CTAG 2 cut(s) 90, 117
Hin1II CATG 2 cut(s) 39, 162
HincII GTYRAC 1 cut(s) 109
HindII GTYRAC 1 cut(s) 109
HinfI GANTC 1 cut(s) 8
HpaI GTTAAC 1 cut(s) 109
Hpy166II GTNNAC 1 cut(s) 109
Hpy188III TCNNGA 2 cut(s) 98, 128
Hpy8I GTNNAC 1 cut(s) 109
HpyAV CCTTC 1 cut(s) 69
HpyCH4V TGCA 3 cut(s) 30, 39, 195
HpyF10VI GCNNNNNNNGC 1 cut(s) 36
HpyF3I CTNAG 2 cut(s) 16, 54
Hsp92II CATG 2 cut(s) 39, 162
Ksp22I TGATCA 1 cut(s) 46
KspAI GTTAAC 1 cut(s) 109
Kzo9I GATC 3 cut(s) 46, 121, 165
LpnPI CCDG 5 cut(s) 35, 91, 111, 171, 176
MaeI CTAG 2 cut(s) 90, 117
MalI GATC 3 cut(s) 48, 123, 167
MboI GATC 3 cut(s) 46, 121, 165
MboII GAAGA 2 cut(s) 3, 116
MflI RGATCY 2 cut(s) 121, 165
MseI TTAA 2 cut(s) 108, 137
MwoI GCNNNNNNNGC 1 cut(s) 36
NdeII GATC 3 cut(s) 46, 121, 165
NlaIII CATG 2 cut(s) 39, 162
NlaIV GGNNCC 2 cut(s) 96, 153
PfeI GAWTC 1 cut(s) 8
PspN4I GGNNCC 2 cut(s) 96, 153
PspPI GGNCC 1 cut(s) 95
PsuI RGATCY 2 cut(s) 121, 165
SaqAI TTAA 2 cut(s) 108, 137
Sau3AI GATC 3 cut(s) 46, 121, 165
Sau96I GGNCC 1 cut(s) 95
SetI ASST 2 cut(s) 83, 135
SinI GGWCC 1 cut(s) 95
SmlI CTYRAG 2 cut(s) 82, 128
SmoI CTYRAG 2 cut(s) 82, 128
SsiI CCGC 1 cut(s) 149
SspMI CTAG 2 cut(s) 90, 117
TfiI GAWTC 1 cut(s) 8
Tru1I TTAA 2 cut(s) 108, 137
Tru9I TTAA 2 cut(s) 108, 137
TspDTI ATGAA 1 cut(s) 24
VpaK11BI GGWCC 1 cut(s) 95
XcmI CCANNNNNNNNNTGG 1 cut(s) 182
XspI CTAG 2 cut(s) 90, 117
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.