Rmu_sc0015723.1_g000001

repressing transcription factor binding

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0015723.1
Physical Location & Seq
Forward (+)
1975 .. 2298
324 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0015723.1_g000001.1.cds

Sequence Viewer

Length: 324 bp
atgattggggctgccacggtgaggatcagtaagggagtggctgaagtgccactcgtggcgactaggcctcagtttaggagacttgggatgtgcaggattttgatgaatcagctcgaaaatcggctcatggaattcggcactgagaggttagtcttgccttctgcgcaaagcgcactcaatacatggactggtagttcaattgggttttcaatgatgactgaggctgagatatcagaactcagtgctcatcatgagttcttggattgtaaggacactgttatgtgccataaaatactcttgaagcacccaatagtgtcattgtga
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

107

Amino Acids

11.91

Weight (kDa)

7.8

Isoelectric Point (pI)

32.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000518)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g21681 FvH4_3g29252 FvH4_3g38950 FvH4_3g44310 FvH4_5g29400
malus_domestica MD03G1066300.v1.1
rosa_chinensis RchiOBHm_Chr2g0087341 RchiOBHm_Chr7g0225691 RchiOBHm_Chr7g0225721 RchiOBHm_Chr7g0225751 RchiOBHm_Chr7g0225781 RchiOBHm_Chr7g0225811 RchiOBHm_Chr7g0225821 RchiOBHm_Chr7g0225841 RchiOBHm_Chr7g0225941
rosa_laevigata RLG00000001777 RLG00000001779 RLG00000001787 RLG00000001796 RLG00000015858 RLG00000018399 RLG00000030202
rosa_multiflora Rmu_co7995100.1_g000001 Rmu_sc0003367.1_g000025 Rmu_sc0004082.1_g000018 Rmu_sc0006064.1_g000002 Rmu_sc0011806.1_g000001 Rmu_sc0014642.1_g000005 Rmu_sc0014767.1_g000003 Rmu_sc0015723.1_g000001 Rmu_sc0030795.1_g000001 Rmu_sc0033647.1_g000001
rosa_roxburghii Rroxscaffold_1G00028220 Rroxscaffold_2G00089180 Rroxscaffold_2G00125860 Rroxscaffold_3G00233350 Rroxscaffold_3G00239570 Rroxscaffold_4G00325690 Rroxscaffold_5G00348560 Rroxscaffold_7G00198070
rosa_rugosa Rorug01G0045600 Rorug01G0474300.1 Rorug07G0220000 Rorug07G0220100 Rorug07G0220200 Rorug07G0220300 Rorug07G0232800 Rorug07G0233000 Rorug07G0233100 Rorug07G0233100 Rorug07G0233200 Rorug07G0233300.1
rosa_samantha Rh1AG061100 Rh1BG052200 Rh1CG063300 Rh1CG063600 Rh1DG067700 Rh2AG027900 Rh2BG027400 Rh2CG028200 Rh2DG028000 Rh7AG369700 Rh7AG370100 Rh7AG371200 Rh7AG387800 Rh7BG366500 Rh7BG366800 Rh7BG367000 Rh7BG367600 Rh7CG388600 Rh7CG389000 Rh7CG389800 Rh7CG407400 Rh7DG377400 Rh7DG377500 Rh7DG377900 Rh7DG378600 Rh7DG378700 Rh7DG378800
rosa_wichuraiana Rw0G020970 Rw0G020980 Rw1G005200 Rw2G002210 Rw7G031830 Rw7G031860 Rw7G031900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 165
AclWI GGATC 1 cut(s) 32
AcsI RAATTY 1 cut(s) 131
AcuI CTGAAG 1 cut(s) 63
AfiI CCNNNNNNNGG 1 cut(s) 21
AgsI TTSAA 3 cut(s) 198, 210, 301
AloI GAACNNNNNNTCC 2 cut(s) 178, 210
AluBI AGCT 1 cut(s) 112
AluI AGCT 1 cut(s) 112
Alw21I GWGCWC 1 cut(s) 247
Alw26I GTCTC 1 cut(s) 73
AlwI GGATC 1 cut(s) 32
AoxI GGCC 1 cut(s) 65
ApeKI GCWGC 1 cut(s) 11
ApoI RAATTY 1 cut(s) 131
AspLEI GCGC 2 cut(s) 166, 173
AsuHPI GGTGA 1 cut(s) 31
BauI CACGAG 1 cut(s) 53
Bbv12I GWGCWC 1 cut(s) 247
BcoDI GTCTC 1 cut(s) 73
BfaI CTAG 1 cut(s) 63
BisI GCNGC 1 cut(s) 12
BlsI GCNGC 1 cut(s) 13
BsaJI CCNNGG 1 cut(s) 15
Bsc4I CCNNNNNNNGG 1 cut(s) 21
Bse1I ACTGG 1 cut(s) 193
BseDI CCNNGG 1 cut(s) 15
BseGI GGATG 1 cut(s) 93
BseLI CCNNNNNNNGG 1 cut(s) 21
BseMII CTCAG 5 cut(s) 83, 132, 210, 216, 253
BseNI ACTGG 1 cut(s) 193
BsgI GTGCAG 1 cut(s) 112
BshFI GGCC 1 cut(s) 67
BsiHKAI GWGCWC 1 cut(s) 247
BslI CCNNNNNNNGG 1 cut(s) 21
BsmAI GTCTC 1 cut(s) 73
BsnI GGCC 1 cut(s) 67
Bsp1286I GDGCHC 1 cut(s) 247
Bsp143I GATC 1 cut(s) 24
BspANI GGCC 1 cut(s) 67
BspCNI CTCAG 5 cut(s) 82, 133, 211, 217, 252
BspHI TCATGA 1 cut(s) 250
BspPI GGATC 1 cut(s) 32
BsrI ACTGG 1 cut(s) 193
BssECI CCNNGG 1 cut(s) 15
BssMI GATC 1 cut(s) 24
BssSI CACGAG 1 cut(s) 53
Bst2BI CACGAG 1 cut(s) 53
Bst4CI ACNGT 2 cut(s) 19, 277
BstDEI CTNAG 5 cut(s) 69, 141, 219, 225, 239
BstDSI CCRYGG 1 cut(s) 15
BstF5I GGATG 1 cut(s) 93
BstHHI GCGC 2 cut(s) 166, 173
BstKTI GATC 1 cut(s) 27
BstMAI GTCTC 1 cut(s) 73
BstMBI GATC 1 cut(s) 24
BstMWI GCNNNNNNNGC 2 cut(s) 163, 170
BsuRI GGCC 1 cut(s) 67
BtgI CCRYGG 1 cut(s) 15
BtsCI GGATG 1 cut(s) 93
BtsIMutI CAGTG 3 cut(s) 138, 247, 273
CciI TCATGA 1 cut(s) 250
CfoI GCGC 2 cut(s) 166, 173
CviAII CATG 3 cut(s) 127, 183, 251
CviJI RGCY 6 cut(s) 11, 41, 67, 112, 124, 224
CviKI_1 RGCY 6 cut(s) 11, 41, 67, 112, 124, 224
DdeI CTNAG 5 cut(s) 69, 141, 219, 225, 239
DpnI GATC 1 cut(s) 26
DpnII GATC 1 cut(s) 24
Eco147I AGGCCT 1 cut(s) 67
Eco32I GATATC 1 cut(s) 231
Eco57I CTGAAG 1 cut(s) 63
EcoRI GAATTC 1 cut(s) 131
EcoRV GATATC 1 cut(s) 231
FaeI CATG 3 cut(s) 130, 186, 254
FaiI YATR 5 cut(s) 128, 184, 252, 281, 288
FatI CATG 3 cut(s) 126, 182, 250
Fnu4HI GCNGC 1 cut(s) 12
FokI GGATG 1 cut(s) 100
Fsp4HI GCNGC 1 cut(s) 12
FspBI CTAG 1 cut(s) 63
FspI TGCGCA 1 cut(s) 165
GlaI GCGC 2 cut(s) 165, 172
GluI GCNGC 1 cut(s) 12
HaeIII GGCC 1 cut(s) 67
HhaI GCGC 2 cut(s) 166, 173
Hin1II CATG 3 cut(s) 130, 186, 254
Hin6I GCGC 2 cut(s) 164, 171
HinP1I GCGC 2 cut(s) 164, 171
HinfI GANTC 1 cut(s) 106
HphI GGTGA 1 cut(s) 31
Hpy188I TCNGA 1 cut(s) 235
Hpy188III TCNNGA 2 cut(s) 251, 298
HpyAV CCTTC 1 cut(s) 168
HpyCH4III ACNGT 2 cut(s) 19, 277
HpyCH4V TGCA 1 cut(s) 93
HpyF10VI GCNNNNNNNGC 2 cut(s) 163, 170
HpyF3I CTNAG 5 cut(s) 69, 141, 219, 225, 239
Hsp92II CATG 3 cut(s) 130, 186, 254
HspAI GCGC 2 cut(s) 164, 171
Kzo9I GATC 1 cut(s) 24
LpnPI CCDG 2 cut(s) 79, 174
MaeI CTAG 1 cut(s) 63
MalI GATC 1 cut(s) 26
MboI GATC 1 cut(s) 24
MfeI CAATTG 1 cut(s) 198
MhlI GDGCHC 1 cut(s) 247
MluCI AATT 2 cut(s) 131, 198
MnlI CCTC 4 cut(s) 15, 78, 138, 214
MslI CAYNNNNRTG 1 cut(s) 278
MunI CAATTG 1 cut(s) 198
MwoI GCNNNNNNNGC 2 cut(s) 163, 170
NdeII GATC 1 cut(s) 24
NlaIII CATG 3 cut(s) 130, 186, 254
NsbI TGCGCA 1 cut(s) 165
PagI TCATGA 1 cut(s) 250
PceI AGGCCT 1 cut(s) 67
PfeI GAWTC 1 cut(s) 106
PkrI GCNGC 1 cut(s) 13
RseI CAYNNNNRTG 1 cut(s) 278
SatI GCNGC 1 cut(s) 12
Sau3AI GATC 1 cut(s) 24
SduI GDGCHC 1 cut(s) 247
SetI ASST 2 cut(s) 114, 149
SmiMI CAYNNNNRTG 1 cut(s) 278
Sse9I AATT 2 cut(s) 131, 198
SseBI AGGCCT 1 cut(s) 67
SspMI CTAG 1 cut(s) 63
StuI AGGCCT 1 cut(s) 67
TaaI ACNGT 2 cut(s) 19, 277
TaqI TCGA 1 cut(s) 114
TasI AATT 2 cut(s) 131, 198
TfiI GAWTC 1 cut(s) 106
TscAI CASTG 3 cut(s) 145, 247, 280
TseI GCWGC 1 cut(s) 11
TspDTI ATGAA 1 cut(s) 119
TspRI CASTG 3 cut(s) 145, 247, 280
XapI RAATTY 1 cut(s) 131
XspI CTAG 1 cut(s) 63
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.