Rmu_sc0020705.1_g000001

U1 small nuclear ribonucleoprotein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0020705.1
Physical Location & Seq
Reverse (-)
1 .. 1196
1196 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0020705.1_g000001.1.cds

Sequence Viewer

Length: 280 bp
atgtgtgatggagcctctaatttgttctttaatgtgatgttcccttgtttcccgcagaacacaaaagataatccaccatgcaataccttatttattggcaatctaggagagagcattaacgaggaagaactgaggggcctattcagctcacaacctggatttaagcaaatgaagatcttgcgacaggaaaggcatactgtttgcttcattgagtttgaagatgtaaacagtgccactgctgtacaccacaattttcaaggtgctgttatccccagttctg

Protein Analysis

93

Amino Acids

10.44

Weight (kDa)

5.15

Isoelectric Point (pI)

50.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 53
AfaI GTAC 1 cut(s) 243
AgsI TTSAA 2 cut(s) 218, 257
AjnI CCWGG 1 cut(s) 154
AluBI AGCT 1 cut(s) 147
AluI AGCT 1 cut(s) 147
AoxI GGCC 1 cut(s) 136
AspS9I GGNCC 1 cut(s) 136
BccI CCATC 1 cut(s) 2
BciT130I CCWGG 1 cut(s) 156
BfaI CTAG 1 cut(s) 104
BglII AGATCT 1 cut(s) 174
Bme1390I CCNGG 1 cut(s) 156
BmgT120I GGNCC 1 cut(s) 136
BmiI GGNNCC 2 cut(s) 13, 137
BmrFI CCNGG 1 cut(s) 156
BmrI ACTGGG 1 cut(s) 267
BmuI ACTGGG 1 cut(s) 267
Bse1I ACTGG 1 cut(s) 273
BseBI CCWGG 1 cut(s) 156
BseMII CTCAG 1 cut(s) 122
BseNI ACTGG 1 cut(s) 273
BshFI GGCC 1 cut(s) 138
BsnI GGCC 1 cut(s) 138
Bsp1407I TGTACA 1 cut(s) 241
Bsp143I GATC 1 cut(s) 174
BspACI CCGC 1 cut(s) 53
BspANI GGCC 1 cut(s) 138
BspCNI CTCAG 1 cut(s) 123
BspLI GGNNCC 2 cut(s) 13, 137
BsrGI TGTACA 1 cut(s) 241
BsrI ACTGG 1 cut(s) 273
BssMI GATC 1 cut(s) 174
Bst2UI CCWGG 1 cut(s) 156
Bst4CI ACNGT 2 cut(s) 199, 230
BstAUI TGTACA 1 cut(s) 241
BstDEI CTNAG 1 cut(s) 131
BstKTI GATC 1 cut(s) 177
BstMBI GATC 1 cut(s) 174
BstMWI GCNNNNNNNGC 1 cut(s) 144
BstNI CCWGG 1 cut(s) 156
BstSCI CCNGG 1 cut(s) 154
BstX2I RGATCY 1 cut(s) 174
BstYI RGATCY 1 cut(s) 174
BsuRI GGCC 1 cut(s) 138
BtsI GCAGTG 1 cut(s) 234
BtsIMutI CAGTG 2 cut(s) 234, 235
Cfr13I GGNCC 1 cut(s) 136
Csp6I GTAC 1 cut(s) 242
CviAII CATG 1 cut(s) 78
CviJI RGCY 3 cut(s) 14, 138, 147
CviKI_1 RGCY 3 cut(s) 14, 138, 147
CviQI GTAC 1 cut(s) 242
DdeI CTNAG 1 cut(s) 131
DpnI GATC 1 cut(s) 176
DpnII GATC 1 cut(s) 174
EcoO109I RGGNCCY 1 cut(s) 136
EcoRII CCWGG 1 cut(s) 154
FaeI CATG 1 cut(s) 81
FaiI YATR 2 cut(s) 79, 195
FatI CATG 1 cut(s) 77
FauI CCCGC 1 cut(s) 60
FspBI CTAG 1 cut(s) 104
HaeIII GGCC 1 cut(s) 138
Hin1II CATG 1 cut(s) 81
Hpy166II GTNNAC 2 cut(s) 226, 244
Hpy8I GTNNAC 2 cut(s) 226, 244
HpyCH4III ACNGT 2 cut(s) 199, 230
HpyCH4V TGCA 1 cut(s) 81
HpyF10VI GCNNNNNNNGC 1 cut(s) 144
HpyF3I CTNAG 1 cut(s) 131
Hsp92II CATG 1 cut(s) 81
Kzo9I GATC 1 cut(s) 174
LmnI GCTCC 1 cut(s) 11
LpnPI CCDG 3 cut(s) 141, 168, 170
MaeI CTAG 1 cut(s) 104
MalI GATC 1 cut(s) 176
MboI GATC 1 cut(s) 174
MboII GAAGA 3 cut(s) 137, 184, 230
MflI RGATCY 1 cut(s) 174
MluCI AATT 2 cut(s) 19, 250
MnlI CCTC 3 cut(s) 25, 115, 126
MseI TTAA 3 cut(s) 30, 117, 162
MspR9I CCNGG 1 cut(s) 156
MvaI CCWGG 1 cut(s) 156
MwoI GCNNNNNNNGC 1 cut(s) 144
NdeII GATC 1 cut(s) 174
NlaIII CATG 1 cut(s) 81
NlaIV GGNNCC 2 cut(s) 13, 137
Psp6I CCWGG 1 cut(s) 154
PspGI CCWGG 1 cut(s) 154
PspN4I GGNNCC 2 cut(s) 13, 137
PspPI GGNCC 1 cut(s) 136
PsuI RGATCY 1 cut(s) 174
RsaI GTAC 1 cut(s) 243
RsaNI GTAC 1 cut(s) 242
SaqAI TTAA 3 cut(s) 30, 117, 162
Sau3AI GATC 1 cut(s) 174
Sau96I GGNCC 1 cut(s) 136
ScrFI CCNGG 1 cut(s) 156
SetI ASST 4 cut(s) 89, 149, 157, 262
Sse9I AATT 2 cut(s) 19, 250
SsiI CCGC 1 cut(s) 53
SspMI CTAG 1 cut(s) 104
StyD4I CCNGG 1 cut(s) 154
TaaI ACNGT 2 cut(s) 199, 230
TasI AATT 2 cut(s) 19, 250
TatI WGTACW 1 cut(s) 241
Tru1I TTAA 3 cut(s) 30, 117, 162
Tru9I TTAA 3 cut(s) 30, 117, 162
TscAI CASTG 2 cut(s) 235, 241
TspDTI ATGAA 2 cut(s) 185, 196
TspRI CASTG 2 cut(s) 235, 241
XspI CTAG 1 cut(s) 104
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.