Rmu_sc0021490.1_g000001

Potassium transporter

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0021490.1
Physical Location & Seq
Reverse (-)
1 .. 3090
3090 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0021490.1_g000001.1.cds

Sequence Viewer

Length: 637 bp
atggctgcacaggaagaccctgacaaaaaaagtggtgtctgggttttggaccagcaacttgatcagcccattgatgtggaggccaagaagatcaaagaaacgaacattcacaagaactgttcatcaatgatggttctgcaacttgcatttcaaagcctcggtgtggtctatggagacttgggcacatctcctttatatgtattctataatatatttcctgatggggttgatgacaaagaggatgttgttggagctttatctgtgattatatggtctcttactttcgttccacttctgaagtatgtctttattgtctgtagagcaaatgacaatggtcaaggcggaacatttgctctttattcattactttgtcgacatgcaaaaataaagagtgttcctaaccaagacgtaactgatgaggaggtaacaacatttagtcgttctacatttggtgagaaatcatttgcagcaagaatcaagagagggttggagaaacatgaattcttgcagaacatgcttcttatccttgtgctgatcggctcttgcatggtgattggggatgggattttgactccggccatatcagttctttcagctgttggtgggatgaatgtgcatcacaaggggattagtaagg

Protein Analysis

212

Amino Acids

23.28

Weight (kDa)

5.94

Isoelectric Point (pI)

38.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 373
AciI CCGC 1 cut(s) 342
AcoI YGGCCR 1 cut(s) 576
AcsI RAATTY 1 cut(s) 500
AcuI CTGAAG 1 cut(s) 317
AfiI CCNNNNNNNGG 1 cut(s) 163
AgsI TTSAA 1 cut(s) 152
AluBI AGCT 2 cut(s) 254, 596
AluI AGCT 2 cut(s) 254, 596
Alw26I GTCTC 2 cut(s) 168, 279
AoxI GGCC 2 cut(s) 81, 576
ApeKI GCWGC 2 cut(s) 5, 467
ApoI RAATTY 1 cut(s) 500
AspS9I GGNCC 1 cut(s) 49
AsuHPI GGTGA 2 cut(s) 464, 562
AvaII GGWCC 1 cut(s) 49
BaeGI GKGCMC 1 cut(s) 185
BbsI GAAGAC 1 cut(s) 21
BbvI GCAGC 1 cut(s) 479
BccI CCATC 3 cut(s) 124, 215, 554
BclI TGATCA 1 cut(s) 61
BcoDI GTCTC 2 cut(s) 168, 279
BfmI CTRYAG 1 cut(s) 316
BisI GCNGC 2 cut(s) 6, 468
BlsI GCNGC 2 cut(s) 7, 469
Bme18I GGWCC 1 cut(s) 49
BmgT120I GGNCC 1 cut(s) 49
BmsI GCATC 1 cut(s) 625
BoxI GACNNNNGTC 1 cut(s) 333
BpiI GAAGAC 1 cut(s) 21
BsaI GGTCTC 1 cut(s) 279
BsaJI CCNNGG 1 cut(s) 157
Bsc4I CCNNNNNNNGG 1 cut(s) 163
BseDI CCNNGG 1 cut(s) 157
BseGI GGATG 3 cut(s) 247, 565, 612
BseLI CCNNNNNNNGG 1 cut(s) 163
BseRI GAGGAG 1 cut(s) 434
BseSI GKGCMC 1 cut(s) 185
BseXI GCAGC 1 cut(s) 479
BshFI GGCC 2 cut(s) 83, 578
BsiSI CCGG 1 cut(s) 575
BslI CCNNNNNNNGG 1 cut(s) 163
BsmAI GTCTC 2 cut(s) 168, 279
BsnI GGCC 2 cut(s) 83, 578
Bso31I GGTCTC 1 cut(s) 279
Bsp1286I GDGCHC 1 cut(s) 185
Bsp143I GATC 3 cut(s) 61, 90, 534
BspACI CCGC 1 cut(s) 342
BspANI GGCC 2 cut(s) 83, 578
BspTNI GGTCTC 1 cut(s) 279
BssECI CCNNGG 1 cut(s) 157
BssMI GATC 3 cut(s) 61, 90, 534
Bst4CI ACNGT 1 cut(s) 119
BstAPI GCANNNNNTGC 1 cut(s) 514
BstF5I GGATG 3 cut(s) 247, 565, 612
BstKTI GATC 3 cut(s) 64, 93, 537
BstMAI GTCTC 2 cut(s) 168, 279
BstMBI GATC 3 cut(s) 61, 90, 534
BstMWI GCNNNNNNNGC 1 cut(s) 514
BstNSI RCATGY 2 cut(s) 380, 517
BstPAI GACNNNNGTC 1 cut(s) 333
BstSFI CTRYAG 1 cut(s) 316
BstSLI GKGCMC 1 cut(s) 185
BstV1I GCAGC 1 cut(s) 479
BstV2I GAAGAC 1 cut(s) 21
BstXI CCANNNNNNTGG 1 cut(s) 76
BsuRI GGCC 2 cut(s) 83, 578
BtsCI GGATG 3 cut(s) 247, 565, 612
Cfr13I GGNCC 1 cut(s) 49
CspCI CAANNNNNGTGG 2 cut(s) 13, 48
CviAII CATG 4 cut(s) 377, 497, 514, 547
CviJI RGCY 8 cut(s) 5, 67, 83, 156, 254, 540, 578, 596
CviKI_1 RGCY 8 cut(s) 5, 67, 83, 156, 254, 540, 578, 596
DpnI GATC 3 cut(s) 63, 92, 536
DpnII GATC 3 cut(s) 61, 90, 534
EaeI YGGCCR 1 cut(s) 576
EciI GGCGGA 1 cut(s) 357
Eco31I GGTCTC 1 cut(s) 279
Eco47I GGWCC 1 cut(s) 49
Eco57I CTGAAG 1 cut(s) 317
EcoRI GAATTC 1 cut(s) 500
FaeI CATG 4 cut(s) 380, 500, 517, 550
FalI AAGNNNNNCTT 2 cut(s) 290, 322
FatI CATG 4 cut(s) 376, 496, 513, 546
FbaI TGATCA 1 cut(s) 61
FblI GTMKAC 1 cut(s) 373
Fnu4HI GCNGC 2 cut(s) 6, 468
FokI GGATG 3 cut(s) 254, 572, 619
Fsp4HI GCNGC 2 cut(s) 6, 468
GluI GCNGC 2 cut(s) 6, 468
HaeIII GGCC 2 cut(s) 83, 578
HapII CCGG 1 cut(s) 575
Hin1II CATG 4 cut(s) 380, 500, 517, 550
HincII GTYRAC 1 cut(s) 374
HindII GTYRAC 1 cut(s) 374
HinfI GANTC 2 cut(s) 474, 571
HpaII CCGG 1 cut(s) 575
HphI GGTGA 2 cut(s) 464, 562
Hpy166II GTNNAC 1 cut(s) 374
Hpy188I TCNGA 1 cut(s) 297
Hpy188III TCNNGA 2 cut(s) 218, 478
Hpy8I GTNNAC 1 cut(s) 374
HpyCH4III ACNGT 1 cut(s) 119
HpyCH4IV ACGT 1 cut(s) 408
HpyCH4V TGCA 8 cut(s) 8, 139, 146, 380, 467, 508, 546, 616
HpyF10VI GCNNNNNNNGC 1 cut(s) 514
HpySE526I ACGT 1 cut(s) 408
Hsp92II CATG 4 cut(s) 380, 500, 517, 550
Ksp22I TGATCA 1 cut(s) 61
Kzo9I GATC 3 cut(s) 61, 90, 534
LmnI GCTCC 1 cut(s) 251
LpnPI CCDG 5 cut(s) 25, 33, 65, 231, 588
Lsp1109I GCAGC 1 cut(s) 479
LweI GCATC 1 cut(s) 625
MaeII ACGT 1 cut(s) 408
MaeIII GTNAC 2 cut(s) 409, 424
MalI GATC 3 cut(s) 63, 92, 536
MboI GATC 3 cut(s) 61, 90, 534
MboII GAAGA 2 cut(s) 26, 100
MhlI GDGCHC 1 cut(s) 185
MluCI AATT 1 cut(s) 500
MlyI GAGTC 1 cut(s) 565
MmeI TCCRAC 2 cut(s) 229, 468
MnlI CCTC 6 cut(s) 73, 167, 232, 412, 415, 476
MslI CAYNNNNRTG 1 cut(s) 74
MspA1I CMGCKG 1 cut(s) 596
MspI CCGG 1 cut(s) 575
MwoI GCNNNNNNNGC 1 cut(s) 514
NdeII GATC 3 cut(s) 61, 90, 534
NlaIII CATG 4 cut(s) 380, 500, 517, 550
NspI RCATGY 2 cut(s) 380, 517
PfeI GAWTC 1 cut(s) 474
PkrI GCNGC 2 cut(s) 7, 469
PleI GAGTC 1 cut(s) 565
PpsI GAGTC 1 cut(s) 565
PshAI GACNNNNGTC 1 cut(s) 333
PspPI GGNCC 1 cut(s) 49
PvuII CAGCTG 1 cut(s) 596
RseI CAYNNNNRTG 1 cut(s) 74
SalI GTCGAC 1 cut(s) 372
SatI GCNGC 2 cut(s) 6, 468
Sau3AI GATC 3 cut(s) 61, 90, 534
Sau96I GGNCC 1 cut(s) 49
SchI GAGTC 1 cut(s) 565
SduI GDGCHC 1 cut(s) 185
SetI ASST 4 cut(s) 256, 411, 426, 598
SfaNI GCATC 1 cut(s) 625
SfcI CTRYAG 1 cut(s) 316
SinI GGWCC 1 cut(s) 49
SmiMI CAYNNNNRTG 1 cut(s) 74
Sse9I AATT 1 cut(s) 500
SsiI CCGC 1 cut(s) 342
TaaI ACNGT 1 cut(s) 119
TaiI ACGT 1 cut(s) 411
TaqI TCGA 1 cut(s) 373
TasI AATT 1 cut(s) 500
TfiI GAWTC 1 cut(s) 474
TseI GCWGC 2 cut(s) 5, 467
TspDTI ATGAA 4 cut(s) 111, 351, 513, 623
VpaK11BI GGWCC 1 cut(s) 49
XapI RAATTY 1 cut(s) 500
XceI RCATGY 2 cut(s) 380, 517
XmiI GTMKAC 1 cut(s) 373
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.