Rmu_sc0034904.1_g000001

Cation H( ) antiporter

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0034904.1
OG0001291
Physical Location & Seq
Reverse (-)
1 .. 1112
1112 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0034904.1_g000001.1.cds

Sequence Viewer

Length: 429 bp
atgttattccttggagggacagatgatcgagaggcattaacatatgcatggaggatggctggccattctgggattcacttgacggttattcggcttaccttgcctaaaacgtcgacagtagacccgacgagactagatgacaaagataattttttgaaggaaatggcaagcactcaaaggcagaaccaatttgatgacttatgcattgatgagttcaggcttaagactatgaacaattccgctatacgactatttgaagagcaagtaagtagttgggaagaaattcacaatatatttaggagcatggaaggggagtatgctctgtgcatagtgggaaaaggccatggaatgacattatccttcaaagaaacatcaatggattacgacgacgacgattttgatgagcttggagcactaggagaagcattg
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Na_H_Exchanger

Protein Analysis

143

Amino Acids

16.34

Weight (kDa)

4.54

Isoelectric Point (pI)

25.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 2 cut(s) 113, 120
AciI CCGC 1 cut(s) 240
AcoI YGGCCR 1 cut(s) 61
AcsI RAATTY 1 cut(s) 282
AflII CTTAAG 1 cut(s) 221
AgsI TTSAA 3 cut(s) 157, 257, 364
AluBI AGCT 1 cut(s) 406
AluI AGCT 1 cut(s) 406
Alw21I GWGCWC 1 cut(s) 415
Alw26I GTCTC 1 cut(s) 124
AoxI GGCC 2 cut(s) 61, 340
ApoI RAATTY 1 cut(s) 282
ArsI GACNNNNNNTTYG 2 cut(s) 380, 412
Asp700I GAANNNNTTC 1 cut(s) 282
BalI TGGCCA 1 cut(s) 63
Bbv12I GWGCWC 1 cut(s) 415
BccI CCATC 1 cut(s) 49
BcoDI GTCTC 1 cut(s) 124
BfaI CTAG 2 cut(s) 134, 416
BfrI CTTAAG 1 cut(s) 221
BsaJI CCNNGG 2 cut(s) 10, 343
BseDI CCNNGG 2 cut(s) 10, 343
BseGI GGATG 1 cut(s) 60
BshFI GGCC 2 cut(s) 63, 342
BsiHKAI GWGCWC 1 cut(s) 415
BslFI GGGAC 1 cut(s) 31
BsmAI GTCTC 1 cut(s) 124
BsmFI GGGAC 1 cut(s) 31
BsnI GGCC 2 cut(s) 63, 342
Bsp1286I GDGCHC 1 cut(s) 415
Bsp143I GATC 1 cut(s) 25
Bsp19I CCATGG 1 cut(s) 343
BspACI CCGC 1 cut(s) 240
BspANI GGCC 2 cut(s) 63, 342
BspQI GCTCTTC 1 cut(s) 252
BspTI CTTAAG 1 cut(s) 221
BssECI CCNNGG 2 cut(s) 10, 343
BssMI GATC 1 cut(s) 25
BssT1I CCWWGG 2 cut(s) 10, 343
Bst4CI ACNGT 2 cut(s) 85, 118
Bst6I CTCTTC 1 cut(s) 252
BstAFI CTTAAG 1 cut(s) 221
BstC8I GCNNGC 2 cut(s) 61, 169
BstDSI CCRYGG 1 cut(s) 343
BstF5I GGATG 1 cut(s) 60
BstKTI GATC 1 cut(s) 28
BstMAI GTCTC 1 cut(s) 124
BstMBI GATC 1 cut(s) 25
BstMWI GCNNNNNNNGC 1 cut(s) 100
BsuRI GGCC 2 cut(s) 63, 342
BtgI CCRYGG 1 cut(s) 343
BtsCI GGATG 1 cut(s) 60
Cac8I GCNNGC 2 cut(s) 61, 169
CviAII CATG 3 cut(s) 48, 304, 344
CviJI RGCY 6 cut(s) 59, 63, 94, 220, 342, 406
CviKI_1 RGCY 6 cut(s) 59, 63, 94, 220, 342, 406
DpnI GATC 1 cut(s) 27
DpnII GATC 1 cut(s) 25
EaeI YGGCCR 1 cut(s) 61
Eam1104I CTCTTC 1 cut(s) 252
EarI CTCTTC 1 cut(s) 252
Eco130I CCWWGG 2 cut(s) 10, 343
EcoT14I CCWWGG 2 cut(s) 10, 343
EcoT22I ATGCAT 2 cut(s) 49, 206
ErhI CCWWGG 2 cut(s) 10, 343
FaeI CATG 3 cut(s) 51, 307, 347
FaqI GGGAC 1 cut(s) 31
FatI CATG 3 cut(s) 47, 303, 343
FauNDI CATATG 1 cut(s) 43
FblI GTMKAC 2 cut(s) 113, 120
FokI GGATG 1 cut(s) 67
FspBI CTAG 2 cut(s) 134, 416
HaeIII GGCC 2 cut(s) 63, 342
Hin1II CATG 3 cut(s) 51, 307, 347
HincII GTYRAC 1 cut(s) 114
HindII GTYRAC 1 cut(s) 114
HinfI GANTC 1 cut(s) 73
Hpy166II GTNNAC 2 cut(s) 114, 121
Hpy188III TCNNGA 1 cut(s) 29
Hpy8I GTNNAC 2 cut(s) 114, 121
Hpy99I CGWCG 5 cut(s) 115, 130, 389, 392, 395
HpyAV CCTTC 3 cut(s) 151, 302, 370
HpyCH4III ACNGT 2 cut(s) 85, 118
HpyCH4IV ACGT 1 cut(s) 110
HpyCH4V TGCA 3 cut(s) 47, 204, 327
HpyF10VI GCNNNNNNNGC 1 cut(s) 100
HpySE526I ACGT 1 cut(s) 110
Hsp92II CATG 3 cut(s) 51, 307, 347
Kzo9I GATC 1 cut(s) 25
LguI GCTCTTC 1 cut(s) 252
LmnI GCTCC 2 cut(s) 300, 410
LpnPI CCDG 3 cut(s) 45, 54, 202
MaeI CTAG 2 cut(s) 134, 416
MaeII ACGT 1 cut(s) 110
MalI GATC 1 cut(s) 27
MboI GATC 1 cut(s) 25
MboII GAAGA 2 cut(s) 269, 290
MhlI GDGCHC 1 cut(s) 415
MlsI TGGCCA 1 cut(s) 63
MluCI AATT 4 cut(s) 148, 188, 235, 282
MluNI TGGCCA 1 cut(s) 63
MnlI CCTC 3 cut(s) 8, 25, 45
Mox20I TGGCCA 1 cut(s) 63
Mph1103I ATGCAT 2 cut(s) 49, 206
MroXI GAANNNNTTC 1 cut(s) 282
MscI TGGCCA 1 cut(s) 63
MseI TTAA 2 cut(s) 38, 222
MslI CAYNNNNRTG 1 cut(s) 46
Msp20I TGGCCA 1 cut(s) 63
MspCI CTTAAG 1 cut(s) 221
MwoI GCNNNNNNNGC 1 cut(s) 100
NcoI CCATGG 1 cut(s) 343
NdeI CATATG 1 cut(s) 43
NdeII GATC 1 cut(s) 25
NlaIII CATG 3 cut(s) 51, 307, 347
NsiI ATGCAT 2 cut(s) 49, 206
PciSI GCTCTTC 1 cut(s) 252
PcsI WCGNNNNNNNCGW 1 cut(s) 390
PdmI GAANNNNTTC 1 cut(s) 282
PfeI GAWTC 1 cut(s) 73
RseI CAYNNNNRTG 1 cut(s) 46
SalI GTCGAC 1 cut(s) 112
SapI GCTCTTC 1 cut(s) 252
SaqAI TTAA 2 cut(s) 38, 222
Sau3AI GATC 1 cut(s) 25
SduI GDGCHC 1 cut(s) 415
SetI ASST 3 cut(s) 101, 113, 408
SmiMI CAYNNNNRTG 1 cut(s) 46
SmlI CTYRAG 1 cut(s) 221
SmoI CTYRAG 1 cut(s) 221
Sse9I AATT 4 cut(s) 148, 188, 235, 282
SsiI CCGC 1 cut(s) 240
SspMI CTAG 2 cut(s) 134, 416
StyI CCWWGG 2 cut(s) 10, 343
TaaI ACNGT 2 cut(s) 85, 118
TaiI ACGT 1 cut(s) 113
TaqI TCGA 2 cut(s) 28, 113
TasI AATT 4 cut(s) 148, 188, 235, 282
TfiI GAWTC 1 cut(s) 73
Tru1I TTAA 2 cut(s) 38, 222
Tru9I TTAA 2 cut(s) 38, 222
TspDTI ATGAA 1 cut(s) 245
Vha464I CTTAAG 1 cut(s) 221
XapI RAATTY 1 cut(s) 282
XmiI GTMKAC 2 cut(s) 113, 120
XmnI GAANNNNTTC 1 cut(s) 282
XspI CTAG 2 cut(s) 134, 416
Zsp2I ATGCAT 2 cut(s) 49, 206
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.