Rroxscaffold_1G00034030

Catalyzes xyloglucan endohydrolysis (XEH) and or endotransglycosylation (XET). Cleaves and religates xyloglucan polymers, an essential constituent of the primary cell wall, and thereby participates in cell wall construction of growing tissues

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
OG0001964
Physical Location & Seq
Reverse (-)
49226416 .. 49227783
1368 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00034030.1

Sequence Viewer

Length: 795 bp
ATGAGTGGTGCTGAACATGTACCCTTTGAGCTAAACTACAACATCACATATAGTTCACATCATACACAATTTCTTAACCAACATGAAGAGATTGTACTATCAATAGATGAACATTCAGGAACTGGATTTAGATCTCTAAAGAGATATGGTTCAGGATTATTTGGTATAAGACTAAAGCTCCCGAGTAATGATACTAGAGGAATCATTACAACCTTTTATTTGATTTCGTTGCCGAACAATGATACCCATCGAGATGAAGTTGATTTTGAATTTTTGGGTAACAAGCAACCACCCTATACGCTAAGTACAAATGTGATTTCAAATGGCAATTTACATCGAGAGCAACAAATTTCTCTATGGTTCGATCCTACAACAGATTTTCATTTATACCAAATTCTATGGAACCAACATCAACTAGTGTTATTTGTAGATGAAATCCCCATTAGAGTGTTTAAAAATGATCCAAGTATCGGACCTATTTTTCCAACAAAGCCAATGGAAATTCAAGGCACTATTTGGAATGCAACATGGGCTAAACATGGATCGTTACCTGATTGGAGCCAAGGACCTTTCAAAGCATATTATCAAGGATTTGATATTGATGGGTGTCCCACAACCAACTTGAACACTACAGAATGTCATGATTATAAGTATGCATGGAATGGAGAATATTATAAGTCTTTGAATCAAGTTCAAGAACATGCATATGAAATTGTCAAGAGATACTACTTGAAATATAACTATTGTAGTATTGCAACCCATCCTTCACCCCCTGAATGCAAGATCAATAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Glyco_hydro_16 XET_C

Protein Analysis

264

Amino Acids

30.68

Weight (kDa)

5.87

Isoelectric Point (pI)

34.62

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Glyco_hydro_16 PF00722 12 - 186 1.4e-45 Glycosyl hydrolases family 16
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 2 cut(s) 648, 675
AclWI GGATC 3 cut(s) 359, 455, 550
AcsI RAATTY 4 cut(s) 269, 348, 393, 501
AfaI GTAC 3 cut(s) 21, 96, 307
AfiI CCNNNNNNNGG 1 cut(s) 470
AflIII ACRYGT 1 cut(s) 16
AgsI TTSAA 8 cut(s) 269, 321, 506, 574, 625, 685, 695, 733
AhlI ACTAGT 1 cut(s) 415
AluBI AGCT 2 cut(s) 31, 178
AluI AGCT 2 cut(s) 31, 178
AlwI GGATC 3 cut(s) 359, 455, 550
AlwNI CAGNNNCTG 1 cut(s) 122
Ama87I CYCGRG 1 cut(s) 181
ApoI RAATTY 4 cut(s) 269, 348, 393, 501
AspS9I GGNCC 2 cut(s) 473, 566
AsuHPI GGTGA 1 cut(s) 759
AvaI CYCGRG 1 cut(s) 181
AvaII GGWCC 2 cut(s) 473, 566
BarI GAAGNNNNNNTAC 2 cut(s) 78, 110
BccI CCATC 3 cut(s) 255, 596, 768
BcuI ACTAGT 1 cut(s) 415
BfaI CTAG 2 cut(s) 195, 416
BfmI CTRYAG 1 cut(s) 630
BglII AGATCT 1 cut(s) 131
Bme18I GGWCC 2 cut(s) 473, 566
BmeT110I CYCGRG 1 cut(s) 181
BmgT120I GGNCC 2 cut(s) 473, 566
BmiI GGNNCC 2 cut(s) 404, 560
BsaBI GATNNNNATC 2 cut(s) 130, 246
BsaJI CCNNGG 1 cut(s) 562
BsaXI ACNNNNNCTCC 2 cut(s) 162, 192
Bsc4I CCNNNNNNNGG 1 cut(s) 470
Bse1I ACTGG 1 cut(s) 127
Bse8I GATNNNNATC 2 cut(s) 130, 246
BseDI CCNNGG 1 cut(s) 562
BseGI GGATG 1 cut(s) 760
BseJI GATNNNNATC 2 cut(s) 130, 246
BseLI CCNNNNNNNGG 1 cut(s) 470
BseNI ACTGG 1 cut(s) 127
BsiHKCI CYCGRG 1 cut(s) 181
BslFI GGGAC 1 cut(s) 594
BslI CCNNNNNNNGG 1 cut(s) 470
BsmFI GGGAC 1 cut(s) 594
BsmI GAATGC 2 cut(s) 526, 782
BsoBI CYCGRG 1 cut(s) 181
Bsp143I GATC 5 cut(s) 131, 364, 460, 542, 783
BspHI TCATGA 1 cut(s) 640
BspLI GGNNCC 2 cut(s) 404, 560
BspPI GGATC 3 cut(s) 359, 455, 550
BsrI ACTGG 1 cut(s) 127
BssECI CCNNGG 1 cut(s) 562
BssMI GATC 5 cut(s) 131, 364, 460, 542, 783
BssT1I CCWWGG 1 cut(s) 562
Bst6I CTCTTC 1 cut(s) 81
BstDEI CTNAG 1 cut(s) 302
BstF5I GGATG 1 cut(s) 760
BstKTI GATC 5 cut(s) 134, 367, 463, 545, 786
BstMBI GATC 5 cut(s) 131, 364, 460, 542, 783
BstMWI GCNNNNNNNGC 1 cut(s) 530
BstNSI RCATGY 2 cut(s) 20, 704
BstSFI CTRYAG 1 cut(s) 630
BstX2I RGATCY 1 cut(s) 131
BstYI RGATCY 1 cut(s) 131
BtsCI GGATG 1 cut(s) 760
CaiI CAGNNNCTG 1 cut(s) 122
CciI TCATGA 1 cut(s) 640
Cfr13I GGNCC 2 cut(s) 473, 566
Csp6I GTAC 3 cut(s) 20, 95, 306
CviAII CATG 7 cut(s) 17, 83, 528, 539, 641, 657, 701
CviJI RGCY 5 cut(s) 31, 178, 493, 533, 561
CviKI_1 RGCY 5 cut(s) 31, 178, 493, 533, 561
CviQI GTAC 3 cut(s) 20, 95, 306
DdeI CTNAG 1 cut(s) 302
DpnI GATC 5 cut(s) 133, 366, 462, 544, 785
DpnII GATC 5 cut(s) 131, 364, 460, 542, 783
DraI TTTAAA 1 cut(s) 454
Eam1104I CTCTTC 1 cut(s) 81
EarI CTCTTC 1 cut(s) 81
Eco130I CCWWGG 1 cut(s) 562
Eco47I GGWCC 2 cut(s) 473, 566
Eco88I CYCGRG 1 cut(s) 181
EcoO109I RGGNCCY 1 cut(s) 566
EcoT14I CCWWGG 1 cut(s) 562
EcoT22I ATGCAT 2 cut(s) 658, 706
ErhI CCWWGG 1 cut(s) 562
FaeI CATG 7 cut(s) 20, 86, 531, 542, 644, 660, 704
FaqI GGGAC 1 cut(s) 594
FatI CATG 7 cut(s) 16, 82, 527, 538, 640, 656, 700
FauNDI CATATG 1 cut(s) 706
FokI GGATG 1 cut(s) 747
FspBI CTAG 2 cut(s) 195, 416
Hin1II CATG 7 cut(s) 20, 86, 531, 542, 644, 660, 704
HinfI GANTC 2 cut(s) 201, 685
HphI GGTGA 1 cut(s) 759
Hpy166II GTNNAC 1 cut(s) 56
Hpy188I TCNGA 1 cut(s) 473
Hpy188III TCNNGA 8 cut(s) 117, 153, 181, 251, 338, 641, 695, 718
Hpy8I GTNNAC 1 cut(s) 56
HpyAV CCTTC 1 cut(s) 774
HpyCH4V TGCA 5 cut(s) 524, 656, 704, 755, 780
HpyF10VI GCNNNNNNNGC 1 cut(s) 530
HpyF3I CTNAG 1 cut(s) 302
Hsp92II CATG 7 cut(s) 20, 86, 531, 542, 644, 660, 704
Kzo9I GATC 5 cut(s) 131, 364, 460, 542, 783
LmnI GCTCC 2 cut(s) 183, 558
LpnPI CCDG 5 cut(s) 102, 108, 138, 564, 786
MaeI CTAG 2 cut(s) 195, 416
MaeIII GTNAC 2 cut(s) 278, 546
MalI GATC 5 cut(s) 133, 366, 462, 544, 785
MboI GATC 5 cut(s) 131, 364, 460, 542, 783
MboII GAAGA 1 cut(s) 98
MflI RGATCY 1 cut(s) 131
MluCI AATT 8 cut(s) 68, 269, 328, 348, 393, 501, 711, 790
MmeI TCCRAC 1 cut(s) 509
MnlI CCTC 1 cut(s) 191
Mph1103I ATGCAT 2 cut(s) 658, 706
MseI TTAA 3 cut(s) 75, 453, 793
MslI CAYNNNNRTG 3 cut(s) 252, 446, 705
Mva1269I GAATGC 2 cut(s) 526, 782
MwoI GCNNNNNNNGC 1 cut(s) 530
NdeI CATATG 1 cut(s) 706
NdeII GATC 5 cut(s) 131, 364, 460, 542, 783
NlaIII CATG 7 cut(s) 20, 86, 531, 542, 644, 660, 704
NlaIV GGNNCC 2 cut(s) 404, 560
NsiI ATGCAT 2 cut(s) 658, 706
NspI RCATGY 2 cut(s) 20, 704
PagI TCATGA 1 cut(s) 640
PciI ACATGT 1 cut(s) 16
PctI GAATGC 2 cut(s) 526, 782
PfeI GAWTC 2 cut(s) 201, 685
PpuMI RGGWCCY 1 cut(s) 566
PscI ACATGT 1 cut(s) 16
PsiI TTATAA 2 cut(s) 648, 675
Psp5II RGGWCCY 1 cut(s) 566
PspN4I GGNNCC 2 cut(s) 404, 560
PspPI GGNCC 2 cut(s) 473, 566
PspPPI RGGWCCY 1 cut(s) 566
PstNI CAGNNNCTG 1 cut(s) 122
PsuI RGATCY 1 cut(s) 131
RsaI GTAC 3 cut(s) 21, 96, 307
RsaNI GTAC 3 cut(s) 20, 95, 306
RseI CAYNNNNRTG 3 cut(s) 252, 446, 705
SaqAI TTAA 3 cut(s) 75, 453, 793
Sau3AI GATC 5 cut(s) 131, 364, 460, 542, 783
Sau96I GGNCC 2 cut(s) 473, 566
SetI ASST 6 cut(s) 33, 180, 215, 478, 553, 571
SfcI CTRYAG 1 cut(s) 630
SinI GGWCC 2 cut(s) 473, 566
SmiMI CAYNNNNRTG 3 cut(s) 252, 446, 705
SpeI ACTAGT 1 cut(s) 415
Sse9I AATT 8 cut(s) 68, 269, 328, 348, 393, 501, 711, 790
SspI AATATT 1 cut(s) 671
SspMI CTAG 2 cut(s) 195, 416
StyI CCWWGG 1 cut(s) 562
TaqI TCGA 3 cut(s) 250, 337, 363
TasI AATT 8 cut(s) 68, 269, 328, 348, 393, 501, 711, 790
TatI WGTACW 2 cut(s) 94, 305
TfiI GAWTC 2 cut(s) 201, 685
Tru1I TTAA 3 cut(s) 75, 453, 793
Tru9I TTAA 3 cut(s) 75, 453, 793
TspDTI ATGAA 6 cut(s) 99, 123, 270, 371, 447, 723
VpaK11BI GGWCC 2 cut(s) 473, 566
XapI RAATTY 4 cut(s) 269, 348, 393, 501
XceI RCATGY 2 cut(s) 20, 704
XspI CTAG 2 cut(s) 195, 416
Zsp2I ATGCAT 2 cut(s) 658, 706
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.