Rh5BG323400

Catalyzes xyloglucan endohydrolysis (XEH) and or endotransglycosylation (XET). Cleaves and religates xyloglucan polymers, an essential constituent of the primary cell wall, and thereby participates in cell wall construction of growing tissues

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
OG0001964
Physical Location & Seq
Forward (+)
43525185 .. 43527201
2017 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG323400.1

Sequence Viewer

Length: 480 bp
ATGAGTGGTGCTGAACATGTACCCTTTGAGCTAAACTACAACATCACATATAGTTCACATCATACACAATTTCTTAACCAACATGAAGAGATTGTACTATCAATAGATAAACATTCAGATGAAATCCCCATTAGAGTGTTTAAAAATGATCCAAGTATCGGACCTATTTTTCCAACAAAGCCAATGGAAATTCAAGGCACTATTTGGAATGCAACATGGGCTAAACATGGATCGTTACCTGATTGGAGTCTAGGACCTTTCAAAGCATATTATCAAGGATTTGATATTGATGGGTGTCCCGCAACCAACTTGAACACTACAGAATGTCATGATTATAAGTATGCATGGAATGGAGAATATTATAAGTCTTTGAATCAAGTTCAAGAACATGCATATGAAATTGTCAAGAGATACTACTTGAAATATAACTATTGTACTGCAACCCATCCTTCACCCCCTGAATGCAAGATCAATAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Glyco_hydro_16 XET_C

Protein Analysis

159

Amino Acids

18.47

Weight (kDa)

5.79

Isoelectric Point (pI)

42.01

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 2 cut(s) 336, 363
AciI CCGC 1 cut(s) 300
AclWI GGATC 2 cut(s) 143, 238
AcsI RAATTY 1 cut(s) 189
AfaI GTAC 3 cut(s) 21, 96, 436
AfiI CCNNNNNNNGG 1 cut(s) 158
AflIII ACRYGT 1 cut(s) 16
AgsI TTSAA 6 cut(s) 194, 262, 313, 373, 383, 421
AluBI AGCT 1 cut(s) 31
AluI AGCT 1 cut(s) 31
AlwI GGATC 2 cut(s) 143, 238
ApoI RAATTY 1 cut(s) 189
AspS9I GGNCC 2 cut(s) 161, 254
AsuHPI GGTGA 1 cut(s) 444
AvaII GGWCC 2 cut(s) 161, 254
BarI GAAGNNNNNNTAC 2 cut(s) 78, 110
BccI CCATC 2 cut(s) 284, 453
BfaI CTAG 1 cut(s) 251
BfmI CTRYAG 1 cut(s) 318
Bme18I GGWCC 2 cut(s) 161, 254
BmgT120I GGNCC 2 cut(s) 161, 254
Bsc4I CCNNNNNNNGG 1 cut(s) 158
BseGI GGATG 1 cut(s) 445
BseLI CCNNNNNNNGG 1 cut(s) 158
BslFI GGGAC 1 cut(s) 282
BslI CCNNNNNNNGG 1 cut(s) 158
BsmFI GGGAC 1 cut(s) 282
BsmI GAATGC 2 cut(s) 214, 467
Bsp143I GATC 3 cut(s) 148, 230, 468
BspACI CCGC 1 cut(s) 300
BspHI TCATGA 1 cut(s) 328
BspPI GGATC 2 cut(s) 143, 238
BssMI GATC 3 cut(s) 148, 230, 468
Bst6I CTCTTC 1 cut(s) 81
BstF5I GGATG 1 cut(s) 445
BstKTI GATC 3 cut(s) 151, 233, 471
BstMBI GATC 3 cut(s) 148, 230, 468
BstMWI GCNNNNNNNGC 1 cut(s) 218
BstNSI RCATGY 2 cut(s) 20, 392
BstSFI CTRYAG 1 cut(s) 318
BtsCI GGATG 1 cut(s) 445
CciI TCATGA 1 cut(s) 328
Cfr13I GGNCC 2 cut(s) 161, 254
Csp6I GTAC 3 cut(s) 20, 95, 435
CviAII CATG 7 cut(s) 17, 83, 216, 227, 329, 345, 389
CviJI RGCY 3 cut(s) 31, 181, 221
CviKI_1 RGCY 3 cut(s) 31, 181, 221
CviQI GTAC 3 cut(s) 20, 95, 435
DpnI GATC 3 cut(s) 150, 232, 470
DpnII GATC 3 cut(s) 148, 230, 468
DraI TTTAAA 1 cut(s) 142
Eam1104I CTCTTC 1 cut(s) 81
EarI CTCTTC 1 cut(s) 81
Eco47I GGWCC 2 cut(s) 161, 254
EcoO109I RGGNCCY 1 cut(s) 254
EcoT22I ATGCAT 2 cut(s) 346, 394
FaeI CATG 7 cut(s) 20, 86, 219, 230, 332, 348, 392
FaqI GGGAC 1 cut(s) 282
FatI CATG 7 cut(s) 16, 82, 215, 226, 328, 344, 388
FauI CCCGC 1 cut(s) 307
FauNDI CATATG 1 cut(s) 394
FokI GGATG 1 cut(s) 432
FspBI CTAG 1 cut(s) 251
Hin1II CATG 7 cut(s) 20, 86, 219, 230, 332, 348, 392
HinfI GANTC 2 cut(s) 247, 373
HphI GGTGA 1 cut(s) 444
Hpy166II GTNNAC 1 cut(s) 56
Hpy188I TCNGA 2 cut(s) 118, 161
Hpy188III TCNNGA 3 cut(s) 329, 383, 406
Hpy8I GTNNAC 1 cut(s) 56
HpyAV CCTTC 1 cut(s) 459
HpyCH4V TGCA 5 cut(s) 212, 344, 392, 440, 465
HpyF10VI GCNNNNNNNGC 1 cut(s) 218
Hsp92II CATG 7 cut(s) 20, 86, 219, 230, 332, 348, 392
Kzo9I GATC 3 cut(s) 148, 230, 468
LpnPI CCDG 2 cut(s) 252, 471
MaeI CTAG 1 cut(s) 251
MaeIII GTNAC 1 cut(s) 234
MalI GATC 3 cut(s) 150, 232, 470
MboI GATC 3 cut(s) 148, 230, 468
MboII GAAGA 1 cut(s) 98
MluCI AATT 4 cut(s) 68, 189, 399, 475
MlyI GAGTC 1 cut(s) 256
MmeI TCCRAC 1 cut(s) 197
Mph1103I ATGCAT 2 cut(s) 346, 394
MseI TTAA 3 cut(s) 75, 141, 478
MslI CAYNNNNRTG 3 cut(s) 117, 134, 393
Mva1269I GAATGC 2 cut(s) 214, 467
MwoI GCNNNNNNNGC 1 cut(s) 218
NdeI CATATG 1 cut(s) 394
NdeII GATC 3 cut(s) 148, 230, 468
NlaIII CATG 7 cut(s) 20, 86, 219, 230, 332, 348, 392
NsiI ATGCAT 2 cut(s) 346, 394
NspI RCATGY 2 cut(s) 20, 392
PagI TCATGA 1 cut(s) 328
PciI ACATGT 1 cut(s) 16
PctI GAATGC 2 cut(s) 214, 467
PfeI GAWTC 1 cut(s) 373
PleI GAGTC 1 cut(s) 255
PpsI GAGTC 1 cut(s) 255
PpuMI RGGWCCY 1 cut(s) 254
PscI ACATGT 1 cut(s) 16
PsiI TTATAA 2 cut(s) 336, 363
Psp5II RGGWCCY 1 cut(s) 254
PspPI GGNCC 2 cut(s) 161, 254
PspPPI RGGWCCY 1 cut(s) 254
RsaI GTAC 3 cut(s) 21, 96, 436
RsaNI GTAC 3 cut(s) 20, 95, 435
RseI CAYNNNNRTG 3 cut(s) 117, 134, 393
SaqAI TTAA 3 cut(s) 75, 141, 478
Sau3AI GATC 3 cut(s) 148, 230, 468
Sau96I GGNCC 2 cut(s) 161, 254
SchI GAGTC 1 cut(s) 256
SetI ASST 4 cut(s) 33, 166, 241, 259
SfcI CTRYAG 1 cut(s) 318
SinI GGWCC 2 cut(s) 161, 254
SmiMI CAYNNNNRTG 3 cut(s) 117, 134, 393
Sse9I AATT 4 cut(s) 68, 189, 399, 475
SsiI CCGC 1 cut(s) 300
SspI AATATT 1 cut(s) 359
SspMI CTAG 1 cut(s) 251
TasI AATT 4 cut(s) 68, 189, 399, 475
TatI WGTACW 2 cut(s) 94, 434
TfiI GAWTC 1 cut(s) 373
Tru1I TTAA 3 cut(s) 75, 141, 478
Tru9I TTAA 3 cut(s) 75, 141, 478
TspDTI ATGAA 3 cut(s) 99, 135, 411
VpaK11BI GGWCC 2 cut(s) 161, 254
XapI RAATTY 1 cut(s) 189
XceI RCATGY 2 cut(s) 20, 392
XspI CTAG 1 cut(s) 251
Zsp2I ATGCAT 2 cut(s) 346, 394
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.