Rroxscaffold_2G00083170

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Forward (+)
5881876 .. 5882419
544 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00083170.1

Sequence Viewer

Length: 438 bp
ATGTCTAGTTCCGAAGCAAACGACGATGACCACATGTCCCTATGGGAACTATTAAGCTCTTCCTCTGACCAAGGCGTGCCATTGCACAGATTTACTATCAGAGGGCGAATTTTACTGGAGGGCTACCTGAAGTCATCAATCGGACTCCTGTGTCGGCGACAAAGCCAAGGAAATGCCTTGCAAGCACAGGTTCCACAGGGCCCGTTTCAAAAAGTGGATGGCGATGAGCACTCTCAGCCCGCAGAGTCAGAAGAGGAAGAAAAAAGTAGTGATGATGATGATGATGATATTAGGTCTATTCTTAATGGTGCTAACTATGAAATTGAAGATATCATATCGGAGGTGAATGGGATACAAGCACTGTCTATGATGATCGATGACGATTCAGTCGGAGATAATTTCACCTTCACCTTCATGTTTAGTTTTAATATTGATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

145

Amino Acids

16.15

Weight (kDa)

4.07

Isoelectric Point (pI)

67.01

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 2 cut(s) 150, 386
AciI CCGC 1 cut(s) 240
AcsI RAATTY 1 cut(s) 108
AcuI CTGAAG 1 cut(s) 149
AflIII ACRYGT 1 cut(s) 33
AgsI TTSAA 2 cut(s) 209, 326
AhdI GACNNNNNGTC 1 cut(s) 34
AluBI AGCT 1 cut(s) 57
AluI AGCT 1 cut(s) 57
Alw21I GWGCWC 1 cut(s) 231
AoxI GGCC 1 cut(s) 199
ApaI GGGCCC 1 cut(s) 203
ApoI RAATTY 1 cut(s) 108
AspS9I GGNCC 2 cut(s) 199, 200
AsuHPI GGTGA 3 cut(s) 355, 394, 400
BaeGI GKGCMC 1 cut(s) 203
BanII GRGCYC 1 cut(s) 203
Bbv12I GWGCWC 1 cut(s) 231
BccI CCATC 1 cut(s) 212
BciVI GTATCC 1 cut(s) 345
BfaI CTAG 1 cut(s) 6
BfuI GTATCC 1 cut(s) 345
BmeRI GACNNNNNGTC 1 cut(s) 34
BmgT120I GGNCC 2 cut(s) 199, 200
BmiI GGNNCC 2 cut(s) 192, 201
BpmI CTGGAG 1 cut(s) 137
Bsa29I ATCGAT 1 cut(s) 375
BsaJI CCNNGG 2 cut(s) 70, 166
Bse1I ACTGG 1 cut(s) 120
Bse3DI GCAATG 1 cut(s) 80
BseCI ATCGAT 1 cut(s) 375
BseDI CCNNGG 2 cut(s) 70, 166
BseGI GGATG 1 cut(s) 223
BseMI GCAATG 1 cut(s) 80
BseMII CTCAG 1 cut(s) 248
BseNI ACTGG 1 cut(s) 120
BseSI GKGCMC 1 cut(s) 203
BshFI GGCC 1 cut(s) 201
BshVI ATCGAT 1 cut(s) 375
BsiHKAI GWGCWC 1 cut(s) 231
BslFI GGGAC 1 cut(s) 22
BsmFI GGGAC 1 cut(s) 22
BsnI GGCC 1 cut(s) 201
Bsp120I GGGCCC 1 cut(s) 199
Bsp1286I GDGCHC 2 cut(s) 203, 231
Bsp143I GATC 1 cut(s) 372
BspACI CCGC 1 cut(s) 240
BspANI GGCC 1 cut(s) 201
BspCNI CTCAG 1 cut(s) 247
BspDI ATCGAT 1 cut(s) 375
BspLI GGNNCC 2 cut(s) 192, 201
BspQI GCTCTTC 1 cut(s) 64
BsrDI GCAATG 1 cut(s) 80
BsrI ACTGG 1 cut(s) 120
BssECI CCNNGG 2 cut(s) 70, 166
BssMI GATC 1 cut(s) 372
BssT1I CCWWGG 2 cut(s) 70, 166
Bst4CI ACNGT 1 cut(s) 363
Bst6I CTCTTC 2 cut(s) 64, 246
BstC8I GCNNGC 3 cut(s) 77, 183, 240
BstDEI CTNAG 1 cut(s) 234
BstF5I GGATG 1 cut(s) 223
BstKTI GATC 1 cut(s) 375
BstMBI GATC 1 cut(s) 372
BstMWI GCNNNNNNNGC 2 cut(s) 182, 235
BstNSI RCATGY 1 cut(s) 37
BstSLI GKGCMC 1 cut(s) 203
Bsu15I ATCGAT 1 cut(s) 375
BsuI GTATCC 1 cut(s) 345
BsuRI GGCC 1 cut(s) 201
BsuTUI ATCGAT 1 cut(s) 375
BtgZI GCGATG 1 cut(s) 237
BtsCI GGATG 1 cut(s) 223
BtsIMutI CAGTG 1 cut(s) 359
Cac8I GCNNGC 3 cut(s) 77, 183, 240
Cfr13I GGNCC 2 cut(s) 199, 200
ClaI ATCGAT 1 cut(s) 375
CviAII CATG 2 cut(s) 34, 415
CviJI RGCY 5 cut(s) 57, 123, 165, 201, 238
CviKI_1 RGCY 5 cut(s) 57, 123, 165, 201, 238
DdeI CTNAG 1 cut(s) 234
DpnI GATC 1 cut(s) 374
DpnII GATC 1 cut(s) 372
DrdI GACNNNNNNGTC 2 cut(s) 150, 386
DriI GACNNNNNGTC 1 cut(s) 34
DseDI GACNNNNNNGTC 2 cut(s) 150, 386
Eam1104I CTCTTC 2 cut(s) 64, 246
Eam1105I GACNNNNNGTC 1 cut(s) 34
EarI CTCTTC 2 cut(s) 64, 246
Eco130I CCWWGG 2 cut(s) 70, 166
Eco24I GRGCYC 1 cut(s) 203
Eco32I GATATC 1 cut(s) 331
Eco57I CTGAAG 1 cut(s) 149
EcoO109I RGGNCCY 1 cut(s) 199
EcoRV GATATC 1 cut(s) 331
EcoT14I CCWWGG 2 cut(s) 70, 166
EcoT38I GRGCYC 1 cut(s) 203
ErhI CCWWGG 2 cut(s) 70, 166
FaeI CATG 2 cut(s) 37, 418
FaiI YATR 6 cut(s) 35, 43, 318, 335, 368, 416
FaqI GGGAC 1 cut(s) 22
FatI CATG 2 cut(s) 33, 414
FauI CCCGC 1 cut(s) 247
FokI GGATG 1 cut(s) 230
FriOI GRGCYC 1 cut(s) 203
FspBI CTAG 1 cut(s) 6
GsuI CTGGAG 1 cut(s) 137
HaeIII GGCC 1 cut(s) 201
Hin1II CATG 2 cut(s) 37, 418
HinfI GANTC 3 cut(s) 144, 245, 383
HphI GGTGA 3 cut(s) 355, 394, 400
Hpy188I TCNGA 7 cut(s) 13, 67, 101, 143, 250, 340, 392
Hpy99I CGWCG 1 cut(s) 26
HpyAV CCTTC 2 cut(s) 415, 421
HpyCH4III ACNGT 1 cut(s) 363
HpyCH4V TGCA 2 cut(s) 85, 181
HpyF10VI GCNNNNNNNGC 2 cut(s) 182, 235
HpyF3I CTNAG 1 cut(s) 234
Hsp92II CATG 2 cut(s) 37, 418
Kzo9I GATC 1 cut(s) 372
LguI GCTCTTC 1 cut(s) 64
LpnPI CCDG 5 cut(s) 101, 140, 161, 173, 182
MaeI CTAG 1 cut(s) 6
MalI GATC 1 cut(s) 374
MboI GATC 1 cut(s) 372
MboII GAAGA 4 cut(s) 51, 263, 269, 338
MhlI GDGCHC 2 cut(s) 203, 231
MluCI AATT 3 cut(s) 108, 321, 397
MlyI GAGTC 2 cut(s) 138, 254
MmeI TCCRAC 1 cut(s) 370
MnlI CCTC 5 cut(s) 73, 95, 112, 247, 334
MseI TTAA 4 cut(s) 53, 303, 426, 436
MslI CAYNNNNRTG 1 cut(s) 413
MwoI GCNNNNNNNGC 2 cut(s) 182, 235
NdeII GATC 1 cut(s) 372
NlaIII CATG 2 cut(s) 37, 418
NlaIV GGNNCC 2 cut(s) 192, 201
NspI RCATGY 1 cut(s) 37
PciI ACATGT 1 cut(s) 33
PciSI GCTCTTC 1 cut(s) 64
PfeI GAWTC 1 cut(s) 383
PleI GAGTC 2 cut(s) 138, 253
PpsI GAGTC 2 cut(s) 138, 253
PscI ACATGT 1 cut(s) 33
PspN4I GGNNCC 2 cut(s) 192, 201
PspOMI GGGCCC 1 cut(s) 199
PspPI GGNCC 2 cut(s) 199, 200
RseI CAYNNNNRTG 1 cut(s) 413
SapI GCTCTTC 1 cut(s) 64
SaqAI TTAA 4 cut(s) 53, 303, 426, 436
Sau3AI GATC 1 cut(s) 372
Sau96I GGNCC 2 cut(s) 199, 200
SchI GAGTC 2 cut(s) 138, 254
SduI GDGCHC 2 cut(s) 203, 231
SetI ASST 7 cut(s) 59, 129, 192, 296, 345, 407, 413
SmiMI CAYNNNNRTG 1 cut(s) 413
Sse9I AATT 3 cut(s) 108, 321, 397
SsiI CCGC 1 cut(s) 240
SspI AATATT 1 cut(s) 430
SspMI CTAG 1 cut(s) 6
StyI CCWWGG 2 cut(s) 70, 166
TaaI ACNGT 1 cut(s) 363
TaqI TCGA 1 cut(s) 375
TasI AATT 3 cut(s) 108, 321, 397
TfiI GAWTC 1 cut(s) 383
Tru1I TTAA 4 cut(s) 53, 303, 426, 436
Tru9I TTAA 4 cut(s) 53, 303, 426, 436
TscAI CASTG 1 cut(s) 366
TspDTI ATGAA 2 cut(s) 333, 403
TspRI CASTG 1 cut(s) 366
XapI RAATTY 1 cut(s) 108
XceI RCATGY 1 cut(s) 37
XspI CTAG 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.