Rroxscaffold_3G00237890

Belongs to the class-I aminoacyl-tRNA synthetase family

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Reverse (-)
25599482 .. 25606169
6688 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00237890.1

Sequence Viewer

Length: 315 bp
ATGACCCGAGATGTTGCTCCACGCATTGGATATCACAAACCTGCTTTAATCGAGTCTCTATTCTTCCCCGCCCTCCAGGGAGAAACGGGAAAAATGTCGGCTAGTGATCCAAATTCTGCCATCTATGTAACTGATTCTGCAAAGGATATTAAGAGCAAGATAAACAAGTTTGCATTTTCAGGGGGACAAGATATAATAGAGAAACACAGGGAGTTGGGAGCAAATCTCGAGGAGTATGGTGCAGGTCGAATGTTGACGGAAAGTGAAGCAGAGGCTCATTCAAGTTTTGACAGAAATTGTGGAGAGACATTGTAG

Protein Analysis

104

Amino Acids

11.37

Weight (kDa)

5.31

Isoelectric Point (pI)

49.31

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
tRNA-synt_1b PF00579 1 - 66 5.4e-09 tRNA synthetases class I (W and Y)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 2 cut(s) 49, 233
AccB7I CCANNNNNTGG 1 cut(s) 26
AciI CCGC 1 cut(s) 69
AclWI GGATC 1 cut(s) 101
AcsI RAATTY 1 cut(s) 112
AfiI CCNNNNNNNGG 1 cut(s) 26
AgsI TTSAA 1 cut(s) 282
AjnI CCWGG 1 cut(s) 75
Alw26I GTCTC 2 cut(s) 60, 299
AlwI GGATC 1 cut(s) 101
Ama87I CYCGRG 2 cut(s) 6, 227
ApoI RAATTY 1 cut(s) 112
AvaI CYCGRG 2 cut(s) 6, 227
BccI CCATC 1 cut(s) 128
BciT130I CCWGG 1 cut(s) 77
BcoDI GTCTC 2 cut(s) 60, 299
BfaI CTAG 1 cut(s) 102
BfuAI ACCTGC 2 cut(s) 49, 233
Bme1390I CCNGG 1 cut(s) 77
BmeT110I CYCGRG 2 cut(s) 6, 227
BmrFI CCNGG 1 cut(s) 77
BplI GAGNNNNNCTC 2 cut(s) 210, 242
BpmI CTGGAG 1 cut(s) 59
BsaJI CCNNGG 1 cut(s) 76
Bsc4I CCNNNNNNNGG 1 cut(s) 26
BseBI CCWGG 1 cut(s) 77
BseDI CCNNGG 1 cut(s) 76
BseLI CCNNNNNNNGG 1 cut(s) 26
BseRI GAGGAG 1 cut(s) 245
BsgI GTGCAG 1 cut(s) 261
BsiHKCI CYCGRG 2 cut(s) 6, 227
BslFI GGGAC 1 cut(s) 198
BslI CCNNNNNNNGG 1 cut(s) 26
BsmAI GTCTC 2 cut(s) 60, 299
BsmFI GGGAC 1 cut(s) 198
BsoBI CYCGRG 2 cut(s) 6, 227
Bsp143I GATC 1 cut(s) 106
BspACI CCGC 1 cut(s) 69
BspMI ACCTGC 2 cut(s) 49, 233
BspPI GGATC 1 cut(s) 101
BssECI CCNNGG 1 cut(s) 76
BssMI GATC 1 cut(s) 106
Bst2UI CCWGG 1 cut(s) 77
BstKTI GATC 1 cut(s) 109
BstMAI GTCTC 2 cut(s) 60, 299
BstMBI GATC 1 cut(s) 106
BstNI CCWGG 1 cut(s) 77
BstSCI CCNGG 1 cut(s) 75
BveI ACCTGC 2 cut(s) 49, 233
CviJI RGCY 2 cut(s) 101, 275
CviKI_1 RGCY 2 cut(s) 101, 275
DpnI GATC 1 cut(s) 108
DpnII GATC 1 cut(s) 106
Eco32I GATATC 1 cut(s) 32
Eco88I CYCGRG 2 cut(s) 6, 227
EcoRII CCWGG 1 cut(s) 75
EcoRV GATATC 1 cut(s) 32
FaiI YATR 3 cut(s) 126, 194, 237
FaqI GGGAC 1 cut(s) 198
FauI CCCGC 1 cut(s) 76
FspBI CTAG 1 cut(s) 102
GsuI CTGGAG 1 cut(s) 59
HincII GTYRAC 1 cut(s) 255
HindII GTYRAC 1 cut(s) 255
HinfI GANTC 2 cut(s) 53, 134
Hpy166II GTNNAC 1 cut(s) 255
Hpy188III TCNNGA 1 cut(s) 227
Hpy8I GTNNAC 1 cut(s) 255
HpyCH4V TGCA 3 cut(s) 140, 173, 242
Kzo9I GATC 1 cut(s) 106
LmnI GCTCC 2 cut(s) 22, 218
LpnPI CCDG 6 cut(s) 54, 62, 89, 165, 193, 228
MaeI CTAG 1 cut(s) 102
MaeIII GTNAC 1 cut(s) 127
MalI GATC 1 cut(s) 108
MboI GATC 1 cut(s) 106
MboII GAAGA 1 cut(s) 55
MluCI AATT 2 cut(s) 112, 295
MlyI GAGTC 1 cut(s) 62
MnlI CCTC 3 cut(s) 83, 223, 265
MseI TTAA 2 cut(s) 47, 150
MspR9I CCNGG 1 cut(s) 77
MvaI CCWGG 1 cut(s) 77
NdeII GATC 1 cut(s) 106
PaeR7I CTCGAG 1 cut(s) 227
PfeI GAWTC 1 cut(s) 134
PflMI CCANNNNNTGG 1 cut(s) 26
PleI GAGTC 1 cut(s) 61
PpsI GAGTC 1 cut(s) 61
Psp6I CCWGG 1 cut(s) 75
PspGI CCWGG 1 cut(s) 75
SaqAI TTAA 2 cut(s) 47, 150
Sau3AI GATC 1 cut(s) 106
SchI GAGTC 1 cut(s) 62
ScrFI CCNGG 1 cut(s) 77
SetI ASST 2 cut(s) 43, 247
Sfr274I CTCGAG 1 cut(s) 227
SlaI CTCGAG 1 cut(s) 227
SmlI CTYRAG 1 cut(s) 227
SmoI CTYRAG 1 cut(s) 227
Sse9I AATT 2 cut(s) 112, 295
SsiI CCGC 1 cut(s) 69
SspMI CTAG 1 cut(s) 102
StyD4I CCNGG 1 cut(s) 75
TaqI TCGA 3 cut(s) 51, 228, 247
TasI AATT 2 cut(s) 112, 295
TfiI GAWTC 1 cut(s) 134
Tru1I TTAA 2 cut(s) 47, 150
Tru9I TTAA 2 cut(s) 47, 150
TspGWI ACGGA 1 cut(s) 272
Van91I CCANNNNNTGG 1 cut(s) 26
XapI RAATTY 1 cut(s) 112
XhoI CTCGAG 1 cut(s) 227
XspI CTAG 1 cut(s) 102
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.