Rroxscaffold_3G00238030

Belongs to the class-I aminoacyl-tRNA synthetase family

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Reverse (-)
26005169 .. 26011846
6678 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00238030.1

Sequence Viewer

Length: 384 bp
ATGACCCGAGATGTTGCTCCACGCATTGGATATCACAAACCTGCTTTAATCGAGTCTCTATTCTTCCCCGCCCTCCAGGGAGAAACGGGAAAAATGTCGGCTAGTGATCCAAATTCTGCCATCTATGTAACTGATTCTGCAAAGGATATTAAGAGCAAGATAAACAAGTTTGCATTTTCAGGGGGACAAGATATAATAGAGAAACACAGGGAGTTGGGAGCAAATCTCGAGGTAGACATTCCATATAAATATCTGAAATTTTTTCTGGATGATGACATCGAGCTTGCTTATATAGGAAAGGAGTATGGTGCAGGTCGAATGTTGACGGAAAGTGAAGCAGAGGCTCATTCAAGTTTTGACAGAAATTGTGGAGAGACATTGTAG

Protein Analysis

127

Amino Acids

14.13

Weight (kDa)

5.02

Isoelectric Point (pI)

40.34

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
tRNA-synt_1b PF00579 1 - 93 3.4e-09 tRNA synthetases class I (W and Y)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 2 cut(s) 49, 302
AccB7I CCANNNNNTGG 1 cut(s) 26
AccI GTMKAC 1 cut(s) 234
AciI CCGC 1 cut(s) 69
AclWI GGATC 1 cut(s) 101
AcsI RAATTY 2 cut(s) 112, 257
AfiI CCNNNNNNNGG 1 cut(s) 26
AgsI TTSAA 1 cut(s) 351
AjnI CCWGG 1 cut(s) 75
AluBI AGCT 1 cut(s) 283
AluI AGCT 1 cut(s) 283
Alw26I GTCTC 2 cut(s) 60, 368
AlwI GGATC 1 cut(s) 101
Ama87I CYCGRG 2 cut(s) 6, 227
ApoI RAATTY 2 cut(s) 112, 257
AvaI CYCGRG 2 cut(s) 6, 227
BccI CCATC 1 cut(s) 128
BciT130I CCWGG 1 cut(s) 77
BcoDI GTCTC 2 cut(s) 60, 368
BfaI CTAG 1 cut(s) 102
BfuAI ACCTGC 2 cut(s) 49, 302
Bme1390I CCNGG 1 cut(s) 77
BmeT110I CYCGRG 2 cut(s) 6, 227
BmrFI CCNGG 1 cut(s) 77
BplI GAGNNNNNCTC 2 cut(s) 210, 242
BpmI CTGGAG 1 cut(s) 59
BsaJI CCNNGG 1 cut(s) 76
Bsc4I CCNNNNNNNGG 1 cut(s) 26
BseBI CCWGG 1 cut(s) 77
BseDI CCNNGG 1 cut(s) 76
BseGI GGATG 1 cut(s) 274
BseLI CCNNNNNNNGG 1 cut(s) 26
BsgI GTGCAG 1 cut(s) 330
BsiHKCI CYCGRG 2 cut(s) 6, 227
BslFI GGGAC 1 cut(s) 198
BslI CCNNNNNNNGG 1 cut(s) 26
BsmAI GTCTC 2 cut(s) 60, 368
BsmFI GGGAC 1 cut(s) 198
BsoBI CYCGRG 2 cut(s) 6, 227
Bsp143I GATC 1 cut(s) 106
BspACI CCGC 1 cut(s) 69
BspMI ACCTGC 2 cut(s) 49, 302
BspPI GGATC 1 cut(s) 101
BssECI CCNNGG 1 cut(s) 76
BssMI GATC 1 cut(s) 106
Bst2UI CCWGG 1 cut(s) 77
BstC8I GCNNGC 1 cut(s) 285
BstF5I GGATG 1 cut(s) 274
BstKTI GATC 1 cut(s) 109
BstMAI GTCTC 2 cut(s) 60, 368
BstMBI GATC 1 cut(s) 106
BstNI CCWGG 1 cut(s) 77
BstSCI CCNGG 1 cut(s) 75
BtsCI GGATG 1 cut(s) 274
BveI ACCTGC 2 cut(s) 49, 302
Cac8I GCNNGC 1 cut(s) 285
CviJI RGCY 3 cut(s) 101, 283, 344
CviKI_1 RGCY 3 cut(s) 101, 283, 344
DpnI GATC 1 cut(s) 108
DpnII GATC 1 cut(s) 106
Eco32I GATATC 1 cut(s) 32
Eco88I CYCGRG 2 cut(s) 6, 227
EcoRII CCWGG 1 cut(s) 75
EcoRV GATATC 1 cut(s) 32
FaiI YATR 7 cut(s) 126, 194, 244, 246, 291, 293, 306
FaqI GGGAC 1 cut(s) 198
FauI CCCGC 1 cut(s) 76
FblI GTMKAC 1 cut(s) 234
FokI GGATG 1 cut(s) 281
FspBI CTAG 1 cut(s) 102
GsuI CTGGAG 1 cut(s) 59
HincII GTYRAC 1 cut(s) 324
HindII GTYRAC 1 cut(s) 324
HinfI GANTC 2 cut(s) 53, 134
Hpy166II GTNNAC 2 cut(s) 235, 324
Hpy188I TCNGA 1 cut(s) 255
Hpy188III TCNNGA 2 cut(s) 227, 266
Hpy8I GTNNAC 2 cut(s) 235, 324
HpyCH4V TGCA 3 cut(s) 140, 173, 311
Kzo9I GATC 1 cut(s) 106
LmnI GCTCC 2 cut(s) 22, 218
LpnPI CCDG 7 cut(s) 54, 62, 89, 165, 193, 251, 297
MaeI CTAG 1 cut(s) 102
MaeIII GTNAC 1 cut(s) 127
MalI GATC 1 cut(s) 108
MboI GATC 1 cut(s) 106
MboII GAAGA 1 cut(s) 55
MluCI AATT 3 cut(s) 112, 257, 364
MlyI GAGTC 1 cut(s) 62
MnlI CCTC 3 cut(s) 83, 223, 334
MseI TTAA 2 cut(s) 47, 150
MspR9I CCNGG 1 cut(s) 77
MvaI CCWGG 1 cut(s) 77
NdeII GATC 1 cut(s) 106
PaeR7I CTCGAG 1 cut(s) 227
PfeI GAWTC 1 cut(s) 134
PflMI CCANNNNNTGG 1 cut(s) 26
PleI GAGTC 1 cut(s) 61
PpsI GAGTC 1 cut(s) 61
Psp6I CCWGG 1 cut(s) 75
PspGI CCWGG 1 cut(s) 75
SaqAI TTAA 2 cut(s) 47, 150
Sau3AI GATC 1 cut(s) 106
SchI GAGTC 1 cut(s) 62
ScrFI CCNGG 1 cut(s) 77
SetI ASST 4 cut(s) 43, 234, 285, 316
Sfr274I CTCGAG 1 cut(s) 227
SlaI CTCGAG 1 cut(s) 227
SmlI CTYRAG 1 cut(s) 227
SmoI CTYRAG 1 cut(s) 227
Sse9I AATT 3 cut(s) 112, 257, 364
SsiI CCGC 1 cut(s) 69
SspMI CTAG 1 cut(s) 102
StyD4I CCNGG 1 cut(s) 75
TaqI TCGA 4 cut(s) 51, 228, 279, 316
TasI AATT 3 cut(s) 112, 257, 364
TfiI GAWTC 1 cut(s) 134
Tru1I TTAA 2 cut(s) 47, 150
Tru9I TTAA 2 cut(s) 47, 150
TspGWI ACGGA 1 cut(s) 341
Van91I CCANNNNNTGG 1 cut(s) 26
XapI RAATTY 2 cut(s) 112, 257
XhoI CTCGAG 1 cut(s) 227
XmiI GTMKAC 1 cut(s) 234
XspI CTAG 1 cut(s) 102
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.