Rorug03G0248200

No description available

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000003
Physical Location & Seq
Reverse (-)
23338207 .. 23338398
192 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug03G0248200.1

Sequence Viewer

Length: 192 bp
ATGTGGTCATTTTCATTATTTTTAGAAGCTGTTGCTATCCTTCCTCAGCTTGTGCTGTTACAGAGAACGAGAAATATTGACAACTTGACAGGGCAATACGTCTTCCTCCTTGGGTATTCCAAACATCCTGATATTTTCTTTACAAATACAATTCTATATCATATTTTTGGTTCCTTCATTAGACCTATATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

63

Amino Acids

7.39

Weight (kDa)

8.23

Isoelectric Point (pI)

38.89

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ER_lumen_recept PF00810 1 - 45 4e-15 ER lumen protein retaining receptor
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AluBI AGCT 2 cut(s) 29, 49
AluI AGCT 2 cut(s) 29, 49
BbsI GAAGAC 1 cut(s) 94
BbvCI CCTCAGC 1 cut(s) 45
BmiI GGNNCC 1 cut(s) 172
BpiI GAAGAC 1 cut(s) 94
Bpu10I CCTNAGC 1 cut(s) 45
BsaJI CCNNGG 1 cut(s) 109
BseDI CCNNGG 1 cut(s) 109
BseGI GGATG 1 cut(s) 124
BseMII CTCAG 1 cut(s) 59
BspCNI CTCAG 1 cut(s) 58
BspLI GGNNCC 1 cut(s) 172
BssECI CCNNGG 1 cut(s) 109
BssT1I CCWWGG 1 cut(s) 109
BstDEI CTNAG 1 cut(s) 45
BstF5I GGATG 1 cut(s) 124
BstV2I GAAGAC 1 cut(s) 94
BtsCI GGATG 1 cut(s) 124
CviJI RGCY 2 cut(s) 29, 49
CviKI_1 RGCY 2 cut(s) 29, 49
DdeI CTNAG 1 cut(s) 45
Eco130I CCWWGG 1 cut(s) 109
EcoT14I CCWWGG 1 cut(s) 109
ErhI CCWWGG 1 cut(s) 109
FaiI YATR 4 cut(s) 157, 162, 188, 190
FokI GGATG 1 cut(s) 111
Hpy188III TCNNGA 1 cut(s) 128
HpyAV CCTTC 2 cut(s) 50, 184
HpyCH4IV ACGT 1 cut(s) 99
HpyF3I CTNAG 1 cut(s) 45
HpySE526I ACGT 1 cut(s) 99
LpnPI CCDG 2 cut(s) 75, 141
MaeII ACGT 1 cut(s) 99
MaeIII GTNAC 1 cut(s) 57
MboII GAAGA 1 cut(s) 94
MluCI AATT 1 cut(s) 150
MnlI CCTC 2 cut(s) 54, 116
NlaIV GGNNCC 1 cut(s) 172
PspN4I GGNNCC 1 cut(s) 172
SetI ASST 4 cut(s) 31, 51, 102, 187
SgeI CNNG 6 cut(s) 62, 81, 97, 102, 122, 140
Sse9I AATT 1 cut(s) 150
SspI AATATT 1 cut(s) 76
StyI CCWWGG 1 cut(s) 109
TaiI ACGT 1 cut(s) 102
TasI AATT 1 cut(s) 150
TspDTI ATGAA 1 cut(s) 166
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.