Rorug06G0266700

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000006
OG0000931
Physical Location & Seq
Forward (+)
41324849 .. 41325040
192 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug06G0266700.1

Sequence Viewer

Length: 192 bp
ATGAAGGATGGTCTCCTTCATACTCTCAACTACAACTGCTCTAGATTACATGTCGAGGGTGACTCTAAATTGGTCGTAGACTGCATTAACAAAAAGTGTGATCCTCCACGGCGTCTACGGTCCTTAATTCTAGACATCCAAAGCATTTCAACCAAGTTTGAAGAGATTGTTTTCAAGCACATTCCTACATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

63

Amino Acids

7.28

Weight (kDa)

8.55

Isoelectric Point (pI)

59.42

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RVT_3 PF13456 3 - 62 2.1e-09 Reverse transcriptase-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 2 cut(s) 78, 115
AclWI GGATC 1 cut(s) 95
AcyI GRCGYC 1 cut(s) 112
AflIII ACRYGT 1 cut(s) 49
AgsI TTSAA 3 cut(s) 150, 161, 175
Alw26I GTCTC 1 cut(s) 17
AlwI GGATC 1 cut(s) 95
AspS9I GGNCC 1 cut(s) 120
AsuHPI GGTGA 1 cut(s) 71
AvaII GGWCC 1 cut(s) 120
BccI CCATC 1 cut(s) 2
BceAI ACGGC 1 cut(s) 125
BcoDI GTCTC 1 cut(s) 17
BfaI CTAG 2 cut(s) 42, 131
Bme18I GGWCC 1 cut(s) 120
BmgT120I GGNCC 1 cut(s) 120
BplI GAGNNNNNCTC 2 cut(s) 47, 79
BsaHI GRCGYC 1 cut(s) 112
BsaI GGTCTC 1 cut(s) 17
BsaJI CCNNGG 1 cut(s) 107
BseDI CCNNGG 1 cut(s) 107
BseGI GGATG 2 cut(s) 13, 135
BsmAI GTCTC 1 cut(s) 17
Bso31I GGTCTC 1 cut(s) 17
Bsp143I GATC 1 cut(s) 100
BspPI GGATC 1 cut(s) 95
BspTNI GGTCTC 1 cut(s) 17
BssECI CCNNGG 1 cut(s) 107
BssMI GATC 1 cut(s) 100
BssNI GRCGYC 1 cut(s) 112
Bst4CI ACNGT 1 cut(s) 120
Bst6I CTCTTC 1 cut(s) 156
BstACI GRCGYC 1 cut(s) 112
BstDSI CCRYGG 1 cut(s) 107
BstF5I GGATG 2 cut(s) 13, 135
BstKTI GATC 1 cut(s) 103
BstMAI GTCTC 1 cut(s) 17
BstMBI GATC 1 cut(s) 100
BstNSI RCATGY 1 cut(s) 53
BtgI CCRYGG 1 cut(s) 107
BtsCI GGATG 2 cut(s) 13, 135
Cfr13I GGNCC 1 cut(s) 120
CseI GACGC 1 cut(s) 101
CviAII CATG 1 cut(s) 50
DpnI GATC 1 cut(s) 102
DpnII GATC 1 cut(s) 100
Eam1104I CTCTTC 1 cut(s) 156
EarI CTCTTC 1 cut(s) 156
Eco31I GGTCTC 1 cut(s) 17
Eco47I GGWCC 1 cut(s) 120
FaeI CATG 1 cut(s) 53
FaiI YATR 3 cut(s) 21, 51, 190
FatI CATG 1 cut(s) 49
FblI GTMKAC 2 cut(s) 78, 115
FokI GGATG 2 cut(s) 20, 122
FspBI CTAG 2 cut(s) 42, 131
HgaI GACGC 1 cut(s) 101
Hin1I GRCGYC 1 cut(s) 112
Hin1II CATG 1 cut(s) 53
HinfI GANTC 1 cut(s) 62
HphI GGTGA 1 cut(s) 71
Hpy166II GTNNAC 2 cut(s) 79, 116
Hpy188III TCNNGA 2 cut(s) 42, 131
Hpy8I GTNNAC 2 cut(s) 79, 116
HpyAV CCTTC 1 cut(s) 26
HpyCH4III ACNGT 1 cut(s) 120
HpyCH4V TGCA 1 cut(s) 84
Hsp92I GRCGYC 1 cut(s) 112
Hsp92II CATG 1 cut(s) 53
Kzo9I GATC 1 cut(s) 100
MaeI CTAG 2 cut(s) 42, 131
MaeIII GTNAC 1 cut(s) 59
MalI GATC 1 cut(s) 102
MboI GATC 1 cut(s) 100
MboII GAAGA 1 cut(s) 173
MluCI AATT 2 cut(s) 68, 126
MlyI GAGTC 1 cut(s) 56
MnlI CCTC 2 cut(s) 49, 114
MseI TTAA 2 cut(s) 87, 125
NdeII GATC 1 cut(s) 100
NlaIII CATG 1 cut(s) 53
NmuCI GTSAC 1 cut(s) 59
NspI RCATGY 1 cut(s) 53
PciI ACATGT 1 cut(s) 49
PleI GAGTC 1 cut(s) 56
PpsI GAGTC 1 cut(s) 56
PscI ACATGT 1 cut(s) 49
PspPI GGNCC 1 cut(s) 120
SaqAI TTAA 2 cut(s) 87, 125
Sau3AI GATC 1 cut(s) 100
Sau96I GGNCC 1 cut(s) 120
SchI GAGTC 1 cut(s) 56
SgeI CNNG 7 cut(s) 54, 62, 67, 120, 143, 166, 187
SinI GGWCC 1 cut(s) 120
Sse9I AATT 2 cut(s) 68, 126
SspMI CTAG 2 cut(s) 42, 131
TaaI ACNGT 1 cut(s) 120
TaqI TCGA 1 cut(s) 54
TasI AATT 2 cut(s) 68, 126
Tru1I TTAA 2 cut(s) 87, 125
Tru9I TTAA 2 cut(s) 87, 125
TseFI GTSAC 1 cut(s) 59
Tsp45I GTSAC 1 cut(s) 59
TspDTI ATGAA 2 cut(s) 8, 17
VpaK11BI GGWCC 1 cut(s) 120
XbaI TCTAGA 2 cut(s) 41, 130
XceI RCATGY 1 cut(s) 53
XmiI GTMKAC 2 cut(s) 78, 115
XspI CTAG 2 cut(s) 42, 131
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.