Rh1DG007800

60S ribosomal Protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1D
Physical Location & Seq
Reverse (-)
1071666 .. 1073209
1544 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1DG007800.1

Sequence Viewer

Length: 240 bp
ATGGTGAACAAGGCCGGAAAAGGAAGAAAGGAGGAGGTCGTTACCAGGGATTACACCATCAATCTCCACAAGCGCCTGCATGGATGCACCTTTAAAAAGAAGGCTCCAAACGCCATAAAGGAAATCAGGAAGTTTGCTCAAAAGGTCATGGCTACTACTAATGTCAGAGTGGATGTTAAACTCAACAAGCACATTTGGAGCCGTGGGATTCGAAGTGTGCCAAGAAGGGTTCGTGTCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

79

Amino Acids

9.21

Weight (kDa)

11.5

Isoelectric Point (pI)

44.48

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_L31e PF01198 12 - 79 6.1e-34 Ribosomal protein L31e
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AjnI CCWGG 1 cut(s) 44
AoxI GGCC 1 cut(s) 12
AspLEI GCGC 1 cut(s) 75
AsuHPI GGTGA 1 cut(s) 16
AsuII TTCGAA 1 cut(s) 211
BccI CCATC 1 cut(s) 65
BceAI ACGGC 1 cut(s) 186
BciT130I CCWGG 1 cut(s) 46
BfoI RGCGCY 1 cut(s) 76
Bme1390I CCNGG 1 cut(s) 46
BmiI GGNNCC 2 cut(s) 105, 200
BmrFI CCNGG 1 cut(s) 46
BmsI GCATC 1 cut(s) 74
Bpu14I TTCGAA 1 cut(s) 211
BsaJI CCNNGG 2 cut(s) 45, 202
BseBI CCWGG 1 cut(s) 46
BseDI CCNNGG 2 cut(s) 45, 202
BseGI GGATG 2 cut(s) 89, 178
BseRI GAGGAG 1 cut(s) 47
BshFI GGCC 1 cut(s) 14
BsiSI CCGG 1 cut(s) 15
BsnI GGCC 1 cut(s) 14
Bsp119I TTCGAA 1 cut(s) 211
BspANI GGCC 1 cut(s) 14
BspLI GGNNCC 2 cut(s) 105, 200
BspT104I TTCGAA 1 cut(s) 211
BssECI CCNNGG 2 cut(s) 45, 202
Bst2UI CCWGG 1 cut(s) 46
BstBI TTCGAA 1 cut(s) 211
BstC8I GCNNGC 1 cut(s) 77
BstDSI CCRYGG 1 cut(s) 202
BstF5I GGATG 2 cut(s) 89, 178
BstH2I RGCGCY 1 cut(s) 76
BstHHI GCGC 1 cut(s) 75
BstMWI GCNNNNNNNGC 1 cut(s) 110
BstNI CCWGG 1 cut(s) 46
BstSCI CCNGG 1 cut(s) 44
BsuRI GGCC 1 cut(s) 14
BtgI CCRYGG 1 cut(s) 202
BtsCI GGATG 2 cut(s) 89, 178
Cac8I GCNNGC 1 cut(s) 77
CfoI GCGC 1 cut(s) 75
CviAII CATG 2 cut(s) 80, 148
CviJI RGCY 4 cut(s) 14, 104, 152, 201
CviKI_1 RGCY 4 cut(s) 14, 104, 152, 201
DraI TTTAAA 1 cut(s) 94
EcoRII CCWGG 1 cut(s) 44
FaeI CATG 2 cut(s) 83, 151
FaiI YATR 3 cut(s) 81, 116, 149
FatI CATG 2 cut(s) 79, 147
FokI GGATG 2 cut(s) 96, 185
GlaI GCGC 1 cut(s) 74
HaeII RGCGCY 1 cut(s) 76
HaeIII GGCC 1 cut(s) 14
HapII CCGG 1 cut(s) 15
HhaI GCGC 1 cut(s) 75
Hin1II CATG 2 cut(s) 83, 151
Hin6I GCGC 1 cut(s) 73
HinP1I GCGC 1 cut(s) 73
HinfI GANTC 1 cut(s) 208
HpaII CCGG 1 cut(s) 15
HphI GGTGA 1 cut(s) 16
Hpy166II GTNNAC 1 cut(s) 7
Hpy188I TCNGA 2 cut(s) 167, 239
Hpy188III TCNNGA 1 cut(s) 127
Hpy8I GTNNAC 1 cut(s) 7
HpyAV CCTTC 2 cut(s) 94, 219
HpyCH4V TGCA 2 cut(s) 79, 87
HpyF10VI GCNNNNNNNGC 1 cut(s) 110
Hsp92II CATG 2 cut(s) 83, 151
HspAI GCGC 1 cut(s) 73
LmnI GCTCC 2 cut(s) 109, 198
LpnPI CCDG 5 cut(s) 28, 31, 58, 89, 112
LweI GCATC 1 cut(s) 74
MaeIII GTNAC 1 cut(s) 40
MboII GAAGA 1 cut(s) 36
MnlI CCTC 2 cut(s) 25, 28
MseI TTAA 2 cut(s) 93, 177
MspI CCGG 1 cut(s) 15
MspR9I CCNGG 1 cut(s) 46
MvaI CCWGG 1 cut(s) 46
MwoI GCNNNNNNNGC 1 cut(s) 110
NlaIII CATG 2 cut(s) 83, 151
NlaIV GGNNCC 2 cut(s) 105, 200
NspV TTCGAA 1 cut(s) 211
PfeI GAWTC 1 cut(s) 208
Psp6I CCWGG 1 cut(s) 44
PspGI CCWGG 1 cut(s) 44
PspN4I GGNNCC 2 cut(s) 105, 200
SaqAI TTAA 2 cut(s) 93, 177
ScrFI CCNGG 1 cut(s) 46
SetI ASST 3 cut(s) 39, 92, 147
SfaNI GCATC 1 cut(s) 74
SfuI TTCGAA 1 cut(s) 211
StyD4I CCNGG 1 cut(s) 44
TaqI TCGA 1 cut(s) 211
TfiI GAWTC 1 cut(s) 208
Tru1I TTAA 2 cut(s) 93, 177
Tru9I TTAA 2 cut(s) 93, 177
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.