Rh2CG046400

Protein RTF2 homolog

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
OG0001837
Physical Location & Seq
Forward (+)
3706642 .. 3706993
352 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG046400.1

Sequence Viewer

Length: 207 bp
ATGCCGAATAGAAATATTGGGATCAATGGGAGTGAGGACGAGGTTGCTGCGCTGAGGGATAGAGCACCACCAAGAGTAGTGAAAAAGGTAAAGAAGACCAAAGATGGGAATGGTGTTGTGAATGGAGAGGAGGGTATGGGTTTTCAAGCTTCAAGGTTAAGTGGTAGAAAGCATGACACTGATGTGGTGAAGGGTGGTTCGACATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Rtf2

Protein Analysis

68

Amino Acids

7.23

Weight (kDa)

9.86

Isoelectric Point (pI)

29.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 29
AfiI CCNNNNNNNGG 1 cut(s) 105
AgsI TTSAA 2 cut(s) 146, 153
AleI CACNNNNGTG 1 cut(s) 182
AluBI AGCT 1 cut(s) 149
AluI AGCT 1 cut(s) 149
Alw21I GWGCWC 1 cut(s) 67
AlwI GGATC 1 cut(s) 29
ApeKI GCWGC 1 cut(s) 47
AspLEI GCGC 1 cut(s) 52
AsuHPI GGTGA 1 cut(s) 199
BbsI GAAGAC 1 cut(s) 101
Bbv12I GWGCWC 1 cut(s) 67
BbvCI CCTCAGC 1 cut(s) 53
BbvI GCAGC 1 cut(s) 34
BccI CCATC 1 cut(s) 98
BcgI CGANNNNNNTGC 2 cut(s) 29, 63
BisI GCNGC 1 cut(s) 48
BlsI GCNGC 1 cut(s) 49
BpiI GAAGAC 1 cut(s) 101
Bpu10I CCTNAGC 1 cut(s) 53
Bsc4I CCNNNNNNNGG 1 cut(s) 105
BseLI CCNNNNNNNGG 1 cut(s) 105
BseMII CTCAG 1 cut(s) 44
BseRI GAGGAG 1 cut(s) 143
BseXI GCAGC 1 cut(s) 34
BsiHKAI GWGCWC 1 cut(s) 67
BslI CCNNNNNNNGG 1 cut(s) 105
Bsp1286I GDGCHC 1 cut(s) 67
Bsp143I GATC 1 cut(s) 21
BspCNI CTCAG 1 cut(s) 45
BspPI GGATC 1 cut(s) 29
BssMI GATC 1 cut(s) 21
BstDEI CTNAG 1 cut(s) 53
BstHHI GCGC 1 cut(s) 52
BstKTI GATC 1 cut(s) 24
BstMBI GATC 1 cut(s) 21
BstV1I GCAGC 1 cut(s) 34
BstV2I GAAGAC 1 cut(s) 101
BtsIMutI CAGTG 1 cut(s) 177
CfoI GCGC 1 cut(s) 52
CviAII CATG 1 cut(s) 173
CviJI RGCY 1 cut(s) 149
CviKI_1 RGCY 1 cut(s) 149
DdeI CTNAG 1 cut(s) 53
DpnI GATC 1 cut(s) 23
DpnII GATC 1 cut(s) 21
FaeI CATG 1 cut(s) 176
FaiI YATR 3 cut(s) 137, 174, 205
FatI CATG 1 cut(s) 172
Fnu4HI GCNGC 1 cut(s) 48
Fsp4HI GCNGC 1 cut(s) 48
GlaI GCGC 1 cut(s) 51
GluI GCNGC 1 cut(s) 48
HhaI GCGC 1 cut(s) 52
Hin1II CATG 1 cut(s) 176
Hin6I GCGC 1 cut(s) 50
HinP1I GCGC 1 cut(s) 50
HindIII AAGCTT 1 cut(s) 147
HphI GGTGA 1 cut(s) 199
HpyAV CCTTC 1 cut(s) 184
HpyF3I CTNAG 1 cut(s) 53
Hsp92II CATG 1 cut(s) 176
HspAI GCGC 1 cut(s) 50
Kzo9I GATC 1 cut(s) 21
Lsp1109I GCAGC 1 cut(s) 34
MalI GATC 1 cut(s) 23
MboI GATC 1 cut(s) 21
MboII GAAGA 1 cut(s) 106
MhlI GDGCHC 1 cut(s) 67
MnlI CCTC 5 cut(s) 28, 34, 48, 121, 124
MseI TTAA 1 cut(s) 158
MslI CAYNNNNRTG 1 cut(s) 182
NdeII GATC 1 cut(s) 21
NlaIII CATG 1 cut(s) 176
OliI CACNNNNGTG 1 cut(s) 182
PkrI GCNGC 1 cut(s) 49
RseI CAYNNNNRTG 1 cut(s) 182
SaqAI TTAA 1 cut(s) 158
SatI GCNGC 1 cut(s) 48
Sau3AI GATC 1 cut(s) 21
SduI GDGCHC 1 cut(s) 67
SetI ASST 4 cut(s) 45, 90, 151, 158
SgeI CNNG 5 cut(s) 52, 84, 158, 165, 185
SmiMI CAYNNNNRTG 1 cut(s) 182
SspI AATATT 1 cut(s) 16
TaqI TCGA 1 cut(s) 200
Tru1I TTAA 1 cut(s) 158
Tru9I TTAA 1 cut(s) 158
TscAI CASTG 1 cut(s) 184
TseI GCWGC 1 cut(s) 47
TspRI CASTG 1 cut(s) 184
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.