Rh6CG151600

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
Physical Location & Seq
Forward (+)
19784655 .. 19784978
324 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG151600.1

Sequence Viewer

Length: 324 bp
ATGAGCAAATTCGCTGGTTCTTCCGGTCAACAAGATGACATTGATGATGTGTGGACGTCCAATTCAACTGCAAATCTCCGGGTTTTCTTGAGTTGTGACAAGGATAAAGCCCCGTCAAGCAAAGAGGTGAAACCAAAATGTGCCAAGAAACTGAACACGGCTTTAATGTCGGTCAAATATGATGATCCTGTTGCAGAGACCGATCAGGCAAAAGACAAGGTAGGCTGCAGTTATGAGGATGGTGTTCATGTAGGATTCAACATGTTCAAGAAATTTGCTGTGAATAAAAATCCACCGGGGGGGTTGGGACAATGTTACAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

107

Amino Acids

11.64

Weight (kDa)

7.61

Isoelectric Point (pI)

34.47

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 59
AclWI GGATC 1 cut(s) 179
AcsI RAATTY 2 cut(s) 8, 272
AcyI GRCGYC 1 cut(s) 56
AfiI CCNNNNNNNGG 1 cut(s) 299
AflIII ACRYGT 1 cut(s) 261
AgsI TTSAA 3 cut(s) 66, 259, 268
Alw26I GTCTC 1 cut(s) 191
AlwI GGATC 1 cut(s) 179
ApeKI GCWGC 1 cut(s) 225
ApoI RAATTY 2 cut(s) 8, 272
AsuC2I CCSGG 2 cut(s) 80, 297
AsuHPI GGTGA 1 cut(s) 139
BbvI GCAGC 1 cut(s) 212
BccI CCATC 1 cut(s) 233
BceAI ACGGC 1 cut(s) 174
BcnI CCSGG 2 cut(s) 80, 297
BcoDI GTCTC 1 cut(s) 191
BfmI CTRYAG 1 cut(s) 226
BisI GCNGC 1 cut(s) 226
BlsI GCNGC 1 cut(s) 227
Bme1390I CCNGG 2 cut(s) 80, 297
BmrFI CCNGG 2 cut(s) 80, 297
BpuEI CTTGAG 1 cut(s) 109
BpuMI CCSGG 2 cut(s) 80, 297
BsaHI GRCGYC 1 cut(s) 56
BsaI GGTCTC 1 cut(s) 191
BsaJI CCNNGG 1 cut(s) 296
BsaWI WCCGGW 1 cut(s) 23
Bsc4I CCNNNNNNNGG 1 cut(s) 299
BseDI CCNNGG 1 cut(s) 296
BseGI GGATG 1 cut(s) 244
BseLI CCNNNNNNNGG 1 cut(s) 299
BseXI GCAGC 1 cut(s) 212
BsiSI CCGG 3 cut(s) 24, 79, 296
BslI CCNNNNNNNGG 1 cut(s) 299
BsmAI GTCTC 1 cut(s) 191
Bso31I GGTCTC 1 cut(s) 191
Bsp143I GATC 2 cut(s) 184, 202
BspMAI CTGCAG 1 cut(s) 230
BspPI GGATC 1 cut(s) 179
BspTNI GGTCTC 1 cut(s) 191
BssECI CCNNGG 1 cut(s) 296
BssMI GATC 2 cut(s) 184, 202
BssNI GRCGYC 1 cut(s) 56
BstACI GRCGYC 1 cut(s) 56
BstF5I GGATG 1 cut(s) 244
BstKTI GATC 2 cut(s) 187, 205
BstMAI GTCTC 1 cut(s) 191
BstMBI GATC 2 cut(s) 184, 202
BstNSI RCATGY 1 cut(s) 265
BstSCI CCNGG 2 cut(s) 78, 295
BstSFI CTRYAG 1 cut(s) 226
BstV1I GCAGC 1 cut(s) 212
BtsCI GGATG 1 cut(s) 244
CviAII CATG 2 cut(s) 248, 262
CviJI RGCY 3 cut(s) 110, 161, 225
CviKI_1 RGCY 3 cut(s) 110, 161, 225
DpnI GATC 2 cut(s) 186, 204
DpnII GATC 2 cut(s) 184, 202
Eco31I GGTCTC 1 cut(s) 191
FaeI CATG 2 cut(s) 251, 265
FaiI YATR 4 cut(s) 180, 234, 249, 263
FatI CATG 2 cut(s) 247, 261
Fnu4HI GCNGC 1 cut(s) 226
FokI GGATG 1 cut(s) 251
Fsp4HI GCNGC 1 cut(s) 226
GluI GCNGC 1 cut(s) 226
HapII CCGG 3 cut(s) 24, 79, 296
Hin1I GRCGYC 1 cut(s) 56
Hin1II CATG 2 cut(s) 251, 265
HincII GTYRAC 1 cut(s) 29
HindII GTYRAC 1 cut(s) 29
HinfI GANTC 1 cut(s) 255
HpaII CCGG 3 cut(s) 24, 79, 296
HphI GGTGA 1 cut(s) 139
Hpy166II GTNNAC 2 cut(s) 29, 54
Hpy188III TCNNGA 2 cut(s) 88, 268
Hpy8I GTNNAC 2 cut(s) 29, 54
HpyCH4IV ACGT 1 cut(s) 56
HpyCH4V TGCA 3 cut(s) 71, 194, 228
HpySE526I ACGT 1 cut(s) 56
Hsp92I GRCGYC 1 cut(s) 56
Hsp92II CATG 2 cut(s) 251, 265
Kzo9I GATC 2 cut(s) 184, 202
LpnPI CCDG 5 cut(s) 37, 92, 191, 201, 309
Lsp1109I GCAGC 1 cut(s) 212
MaeII ACGT 1 cut(s) 56
MaeIII GTNAC 2 cut(s) 95, 314
MalI GATC 2 cut(s) 186, 204
MboI GATC 2 cut(s) 184, 202
MboII GAAGA 1 cut(s) 12
MfeI CAATTG 1 cut(s) 319
MluCI AATT 4 cut(s) 8, 61, 272, 319
MnlI CCTC 2 cut(s) 118, 229
MseI TTAA 1 cut(s) 164
MspI CCGG 3 cut(s) 24, 79, 296
MspR9I CCNGG 2 cut(s) 80, 297
MunI CAATTG 1 cut(s) 319
NciI CCSGG 2 cut(s) 80, 297
NdeII GATC 2 cut(s) 184, 202
NlaIII CATG 2 cut(s) 251, 265
NmuCI GTSAC 1 cut(s) 95
NspI RCATGY 1 cut(s) 265
PciI ACATGT 1 cut(s) 261
PfeI GAWTC 1 cut(s) 255
PkrI GCNGC 1 cut(s) 227
PscI ACATGT 1 cut(s) 261
PstI CTGCAG 1 cut(s) 230
SaqAI TTAA 1 cut(s) 164
SatI GCNGC 1 cut(s) 226
Sau3AI GATC 2 cut(s) 184, 202
ScrFI CCNGG 2 cut(s) 80, 297
SetI ASST 3 cut(s) 59, 129, 222
SfcI CTRYAG 1 cut(s) 226
SmlI CTYRAG 1 cut(s) 88
SmoI CTYRAG 1 cut(s) 88
Sse9I AATT 4 cut(s) 8, 61, 272, 319
StyD4I CCNGG 2 cut(s) 78, 295
TaiI ACGT 1 cut(s) 59
TaqII GACCGA 2 cut(s) 160, 215
TasI AATT 4 cut(s) 8, 61, 272, 319
TfiI GAWTC 1 cut(s) 255
Tru1I TTAA 1 cut(s) 164
Tru9I TTAA 1 cut(s) 164
TseFI GTSAC 1 cut(s) 95
TseI GCWGC 1 cut(s) 225
Tsp45I GTSAC 1 cut(s) 95
TspDTI ATGAA 1 cut(s) 236
XapI RAATTY 2 cut(s) 8, 272
XceI RCATGY 1 cut(s) 265
ZraI GACGTC 1 cut(s) 57
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.