AT1G58160

gag-polypeptide of LTR copia-type

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
1
OG0000646
Physical Location & Seq
Forward (+)
21533724 .. 21534440
717 bp
Loading structure...
UTR
Exon/CDS
Intron
AT1G58160.1

Sequence Viewer

Length: 396 bp
ATGTCTACACCATCAGGTTCAAATCCGTTACCAATGGCCGACAAGTTAGAAGCAAAAGGTCGTATAGCATCCATCAAGTTCGACTATGTCAAGAATGGTCAACCTAAAGCTGGATCAACCCATGGTGTCTCATATCACAATTTCACCGAGTGGTTTGATCTTAACCATACATGCGATGAGCATATCTTATCTGTGAAGTGTTACTACGATGATGGTGAGATACAAGGACTTGTGATCAAAACCAATATCAGGACGTCTGCATATATGGGATATAACATTGGTACTACGTTTACACTTGAAGTCAAAGGCAAGAAGATCGTTGGGTTTCATGGATCTTTTGATAAAAACCTTACCTCGCTTGGAGCTTATTTCGCACCGCTTTCTCCTGCTAAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

131

Amino Acids

14.4

Weight (kDa)

8.49

Isoelectric Point (pI)

34.41

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Jacalin PF01419 20 - 123 1.4e-22 Jacalin-like lectin domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 257
AccI GTMKAC 1 cut(s) 5
AciI CCGC 1 cut(s) 377
AclWI GGATC 2 cut(s) 121, 340
AcoI YGGCCR 1 cut(s) 36
AcyI GRCGYC 1 cut(s) 254
AdeI CACNNNGTG 1 cut(s) 150
AfaI GTAC 1 cut(s) 283
AfiI CCNNNNNNNGG 2 cut(s) 110, 249
AgsI TTSAA 2 cut(s) 21, 299
AluBI AGCT 2 cut(s) 110, 365
AluI AGCT 2 cut(s) 110, 365
Alw26I GTCTC 1 cut(s) 133
AlwI GGATC 2 cut(s) 121, 340
AoxI GGCC 1 cut(s) 36
AsuHPI GGTGA 2 cut(s) 136, 227
BarI GAAGNNNNNNTAC 2 cut(s) 188, 220
BccI CCATC 3 cut(s) 19, 80, 206
BcgI CGANNNNNNTGC 2 cut(s) 298, 332
BclI TGATCA 1 cut(s) 234
BcoDI GTCTC 1 cut(s) 133
BmsI GCATC 1 cut(s) 77
BsaHI GRCGYC 1 cut(s) 254
BsaJI CCNNGG 1 cut(s) 121
Bsc4I CCNNNNNNNGG 2 cut(s) 110, 249
BseDI CCNNGG 1 cut(s) 121
BseGI GGATG 1 cut(s) 68
BseLI CCNNNNNNNGG 2 cut(s) 110, 249
BshFI GGCC 1 cut(s) 38
BslI CCNNNNNNNGG 2 cut(s) 110, 249
BsmAI GTCTC 1 cut(s) 133
BsnI GGCC 1 cut(s) 38
Bsp143I GATC 5 cut(s) 113, 157, 234, 315, 332
Bsp19I CCATGG 1 cut(s) 121
BspACI CCGC 1 cut(s) 377
BspANI GGCC 1 cut(s) 38
BspPI GGATC 2 cut(s) 121, 340
BssECI CCNNGG 1 cut(s) 121
BssMI GATC 5 cut(s) 113, 157, 234, 315, 332
BssNI GRCGYC 1 cut(s) 254
BssT1I CCWWGG 1 cut(s) 121
BstACI GRCGYC 1 cut(s) 254
BstDEI CTNAG 1 cut(s) 390
BstDSI CCRYGG 1 cut(s) 121
BstF5I GGATG 1 cut(s) 68
BstKTI GATC 5 cut(s) 116, 160, 237, 318, 335
BstMAI GTCTC 1 cut(s) 133
BstMBI GATC 5 cut(s) 113, 157, 234, 315, 332
BstMWI GCNNNNNNNGC 1 cut(s) 371
BstNSI RCATGY 1 cut(s) 174
BstX2I RGATCY 1 cut(s) 332
BstYI RGATCY 1 cut(s) 332
BsuRI GGCC 1 cut(s) 38
BtgI CCRYGG 1 cut(s) 121
BtgZI GCGATG 1 cut(s) 189
BtsCI GGATG 1 cut(s) 68
Csp6I GTAC 1 cut(s) 282
CviAII CATG 3 cut(s) 122, 171, 329
CviJI RGCY 3 cut(s) 38, 110, 365
CviKI_1 RGCY 3 cut(s) 38, 110, 365
CviQI GTAC 1 cut(s) 282
DdeI CTNAG 1 cut(s) 390
DpnI GATC 5 cut(s) 115, 159, 236, 317, 334
DpnII GATC 5 cut(s) 113, 157, 234, 315, 332
DraIII CACNNNGTG 1 cut(s) 150
EaeI YGGCCR 1 cut(s) 36
Eco130I CCWWGG 1 cut(s) 121
EcoT14I CCWWGG 1 cut(s) 121
ErhI CCWWGG 1 cut(s) 121
FaeI CATG 3 cut(s) 125, 174, 332
FatI CATG 3 cut(s) 121, 170, 328
FbaI TGATCA 1 cut(s) 234
FblI GTMKAC 1 cut(s) 5
FokI GGATG 1 cut(s) 55
HaeIII GGCC 1 cut(s) 38
Hin1I GRCGYC 1 cut(s) 254
Hin1II CATG 3 cut(s) 125, 174, 332
HincII GTYRAC 1 cut(s) 101
HindII GTYRAC 1 cut(s) 101
HphI GGTGA 2 cut(s) 136, 227
Hpy166II GTNNAC 3 cut(s) 6, 101, 291
Hpy188III TCNNGA 2 cut(s) 91, 250
Hpy8I GTNNAC 3 cut(s) 6, 101, 291
HpyCH4IV ACGT 2 cut(s) 254, 287
HpyCH4V TGCA 1 cut(s) 260
HpyF10VI GCNNNNNNNGC 1 cut(s) 371
HpyF3I CTNAG 1 cut(s) 390
HpySE526I ACGT 2 cut(s) 254, 287
Hsp92I GRCGYC 1 cut(s) 254
Hsp92II CATG 3 cut(s) 125, 174, 332
Ksp22I TGATCA 1 cut(s) 234
Kzo9I GATC 5 cut(s) 113, 157, 234, 315, 332
LmnI GCTCC 1 cut(s) 362
LpnPI CCDG 2 cut(s) 96, 235
LweI GCATC 1 cut(s) 77
MaeII ACGT 2 cut(s) 254, 287
MaeIII GTNAC 2 cut(s) 27, 200
MalI GATC 5 cut(s) 115, 159, 236, 317, 334
MboI GATC 5 cut(s) 113, 157, 234, 315, 332
MboII GAAGA 1 cut(s) 325
MflI RGATCY 1 cut(s) 332
MluCI AATT 1 cut(s) 139
MnlI CCTC 1 cut(s) 364
MseI TTAA 1 cut(s) 162
MwoI GCNNNNNNNGC 1 cut(s) 371
NcoI CCATGG 1 cut(s) 121
NdeII GATC 5 cut(s) 113, 157, 234, 315, 332
NlaIII CATG 3 cut(s) 125, 174, 332
NspI RCATGY 1 cut(s) 174
PflFI GACNNNGTC 1 cut(s) 86
PsuI RGATCY 1 cut(s) 332
PsyI GACNNNGTC 1 cut(s) 86
RsaI GTAC 1 cut(s) 283
RsaNI GTAC 1 cut(s) 282
SaqAI TTAA 1 cut(s) 162
Sau3AI GATC 5 cut(s) 113, 157, 234, 315, 332
SetI ASST 9 cut(s) 19, 61, 106, 112, 257, 290, 351, 356, 367
SfaNI GCATC 1 cut(s) 77
Sse9I AATT 1 cut(s) 139
SsiI CCGC 1 cut(s) 377
StyI CCWWGG 1 cut(s) 121
TaiI ACGT 2 cut(s) 257, 290
TaqI TCGA 1 cut(s) 81
TasI AATT 1 cut(s) 139
Tru1I TTAA 1 cut(s) 162
Tru9I TTAA 1 cut(s) 162
TspDTI ATGAA 1 cut(s) 317
TspGWI ACGGA 1 cut(s) 15
Tth111I GACNNNGTC 1 cut(s) 86
XceI RCATGY 1 cut(s) 174
XmiI GTMKAC 1 cut(s) 5
ZraI GACGTC 1 cut(s) 255
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.