AT5G41450

Contains the following InterPro domains Zinc finger, RING-type (InterPro IPR001841), Zinc finger, C3HC4 RING-type (InterPro IPR018957)

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
5
Physical Location & Seq
Reverse (-)
16588600 .. 16589094
495 bp
Loading structure...
UTR
Exon/CDS
Intron
AT5G41450.1

Sequence Viewer

Length: 495 bp
ATGATGGAGTCTCCACCGTCAGATAATCTGGATTTTTTTTCGACAGTATTGTTTTTATTTATATATATGGTATTTCCAATTGCCATTACAGTAATCTTTATTTATAAACTTTGCATAGATCTTAGTCAGCAACCTCCTACGGAAATAGCTCGTGAGACACACCAAAATTCTCATCCACCACCTGATCAGCTTCAACAAGACATTGAGACTGGACATGTAACGCTGCCTCAGCCTCAACAAAACATTGCAGTCGGATATATGACATGGATCCATGAAACGACAATTTTAGAGTTTAAAGATATAAAAGAAGGATCCAATAAGATTTTTTGTCCAATATGTCTTGAAGAGTTTGAAGATGGCCATGAGATAATTCGTATAAATATGTGTAGACATGTTTTTCATCGTTTTTGTATTGATCCTTGGCTCAATCAGAATCTAACCTGCCCGAATTGTCGATGCTCCCTTACTGCAAGAAAGAGGAAAGAGGGTGAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

164

Amino Acids

19.14

Weight (kDa)

5.3

Isoelectric Point (pI)

54.61

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
zf-RING_2 PF13639 110 - 152 2.3e-13 Ring finger domain
zf-C3HC4_2 PF13923 110 - 151 2e-09 Zinc finger, C3HC4 type (RING finger)
zf-C3HC4 PF00097 110 - 151 2.2e-08 Zinc finger, C3HC4 type (RING finger)
zf-RING_UBOX PF13445 110 - 149 2.3e-07 RING-type zinc-finger
zf-rbx1 PF12678 110 - 152 5.8e-07 RING-H2 zinc finger domain
zf-RING_11 PF17123 110 - 138 2.6e-06 RING-like zinc finger
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 105
Acc36I ACCTGC 1 cut(s) 449
AccI GTMKAC 1 cut(s) 388
AclWI GGATC 5 cut(s) 262, 275, 306, 319, 410
AcoI YGGCCR 1 cut(s) 358
AcsI RAATTY 1 cut(s) 166
AflIII ACRYGT 2 cut(s) 214, 391
AgsI TTSAA 3 cut(s) 194, 344, 353
AluBI AGCT 2 cut(s) 149, 190
AluI AGCT 2 cut(s) 149, 190
Alw26I GTCTC 3 cut(s) 15, 149, 200
AlwI GGATC 5 cut(s) 262, 275, 306, 319, 410
AoxI GGCC 1 cut(s) 358
ApeKI GCWGC 1 cut(s) 223
ApoI RAATTY 1 cut(s) 166
BalI TGGCCA 1 cut(s) 360
BamHI GGATCC 2 cut(s) 267, 311
BauI CACGAG 1 cut(s) 150
BbvCI CCTCAGC 1 cut(s) 228
BbvI GCAGC 1 cut(s) 210
BccI CCATC 1 cut(s) 350
BclI TGATCA 1 cut(s) 184
BcoDI GTCTC 3 cut(s) 15, 149, 200
BfuAI ACCTGC 1 cut(s) 449
BglII AGATCT 1 cut(s) 118
BisI GCNGC 1 cut(s) 224
BlsI GCNGC 1 cut(s) 225
BmiI GGNNCC 2 cut(s) 269, 313
BmsI GCATC 1 cut(s) 446
Bpu10I CCTNAGC 1 cut(s) 228
BsaJI CCNNGG 1 cut(s) 419
Bse1I ACTGG 1 cut(s) 214
Bse3DI GCAATG 1 cut(s) 243
BseDI CCNNGG 1 cut(s) 419
BseGI GGATG 1 cut(s) 172
BseMI GCAATG 1 cut(s) 243
BseMII CTCAG 1 cut(s) 242
BseNI ACTGG 1 cut(s) 214
BseXI GCAGC 1 cut(s) 210
BshFI GGCC 1 cut(s) 360
BsmAI GTCTC 3 cut(s) 15, 149, 200
BsnI GGCC 1 cut(s) 360
Bsp143I GATC 5 cut(s) 118, 184, 267, 311, 415
BspANI GGCC 1 cut(s) 360
BspCNI CTCAG 1 cut(s) 241
BspLI GGNNCC 2 cut(s) 269, 313
BspMI ACCTGC 1 cut(s) 449
BspPI GGATC 5 cut(s) 262, 275, 306, 319, 410
BsrDI GCAATG 1 cut(s) 243
BsrI ACTGG 1 cut(s) 214
BssECI CCNNGG 1 cut(s) 419
BssMI GATC 5 cut(s) 118, 184, 267, 311, 415
BssSI CACGAG 1 cut(s) 150
BssT1I CCWWGG 1 cut(s) 419
Bst2BI CACGAG 1 cut(s) 150
Bst4CI ACNGT 3 cut(s) 18, 46, 91
Bst6I CTCTTC 1 cut(s) 339
BstDEI CTNAG 2 cut(s) 122, 228
BstF5I GGATG 1 cut(s) 172
BstKTI GATC 5 cut(s) 121, 187, 270, 314, 418
BstMAI GTCTC 3 cut(s) 15, 149, 200
BstMBI GATC 5 cut(s) 118, 184, 267, 311, 415
BstMWI GCNNNNNNNGC 1 cut(s) 229
BstNSI RCATGY 2 cut(s) 218, 395
BstV1I GCAGC 1 cut(s) 210
BstX2I RGATCY 3 cut(s) 118, 267, 311
BstYI RGATCY 3 cut(s) 118, 267, 311
BsuRI GGCC 1 cut(s) 360
BtsCI GGATG 1 cut(s) 172
BveI ACCTGC 1 cut(s) 449
CviAII CATG 5 cut(s) 215, 264, 272, 362, 392
CviJI RGCY 5 cut(s) 149, 190, 232, 360, 424
CviKI_1 RGCY 5 cut(s) 149, 190, 232, 360, 424
DdeI CTNAG 2 cut(s) 122, 228
DpnI GATC 5 cut(s) 120, 186, 269, 313, 417
DpnII GATC 5 cut(s) 118, 184, 267, 311, 415
DraI TTTAAA 1 cut(s) 295
EaeI YGGCCR 1 cut(s) 358
Eam1104I CTCTTC 1 cut(s) 339
EarI CTCTTC 1 cut(s) 339
Eco130I CCWWGG 1 cut(s) 419
EcoT14I CCWWGG 1 cut(s) 419
ErhI CCWWGG 1 cut(s) 419
FaeI CATG 5 cut(s) 218, 267, 275, 365, 395
FatI CATG 5 cut(s) 214, 263, 271, 361, 391
FbaI TGATCA 1 cut(s) 184
FblI GTMKAC 1 cut(s) 388
Fnu4HI GCNGC 1 cut(s) 224
FokI GGATG 1 cut(s) 159
Fsp4HI GCNGC 1 cut(s) 224
GluI GCNGC 1 cut(s) 224
HaeIII GGCC 1 cut(s) 360
Hin1II CATG 5 cut(s) 218, 267, 275, 365, 395
HinfI GANTC 2 cut(s) 8, 433
Hpy166II GTNNAC 1 cut(s) 389
Hpy188I TCNGA 3 cut(s) 22, 254, 432
Hpy188III TCNNGA 3 cut(s) 29, 152, 341
Hpy8I GTNNAC 1 cut(s) 389
HpyAV CCTTC 1 cut(s) 302
HpyCH4III ACNGT 3 cut(s) 18, 46, 91
HpyCH4V TGCA 3 cut(s) 114, 248, 470
HpyF10VI GCNNNNNNNGC 1 cut(s) 229
HpyF3I CTNAG 2 cut(s) 122, 228
Hsp92II CATG 5 cut(s) 218, 267, 275, 365, 395
Ksp22I TGATCA 1 cut(s) 184
Kzo9I GATC 5 cut(s) 118, 184, 267, 311, 415
LmnI GCTCC 1 cut(s) 464
LpnPI CCDG 4 cut(s) 14, 195, 195, 454
Lsp1109I GCAGC 1 cut(s) 210
LweI GCATC 1 cut(s) 446
MaeIII GTNAC 1 cut(s) 217
MalI GATC 5 cut(s) 120, 186, 269, 313, 417
MboI GATC 5 cut(s) 118, 184, 267, 311, 415
MboII GAAGA 2 cut(s) 356, 365
MfeI CAATTG 1 cut(s) 78
MflI RGATCY 3 cut(s) 118, 267, 311
MlsI TGGCCA 1 cut(s) 360
MluCI AATT 5 cut(s) 78, 166, 282, 369, 448
MluNI TGGCCA 1 cut(s) 360
MlyI GAGTC 1 cut(s) 17
MmeI TCCRAC 1 cut(s) 232
MnlI CCTC 5 cut(s) 144, 237, 243, 471, 478
Mox20I TGGCCA 1 cut(s) 360
MscI TGGCCA 1 cut(s) 360
MseI TTAA 1 cut(s) 294
Msp20I TGGCCA 1 cut(s) 360
MunI CAATTG 1 cut(s) 78
MwoI GCNNNNNNNGC 1 cut(s) 229
NdeII GATC 5 cut(s) 118, 184, 267, 311, 415
NlaIII CATG 5 cut(s) 218, 267, 275, 365, 395
NlaIV GGNNCC 2 cut(s) 269, 313
NspI RCATGY 2 cut(s) 218, 395
PciI ACATGT 2 cut(s) 214, 391
PfeI GAWTC 1 cut(s) 433
PkrI GCNGC 1 cut(s) 225
PleI GAGTC 1 cut(s) 16
PpsI GAGTC 1 cut(s) 16
PscI ACATGT 2 cut(s) 214, 391
PsiI TTATAA 1 cut(s) 105
PspN4I GGNNCC 2 cut(s) 269, 313
PsuI RGATCY 3 cut(s) 118, 267, 311
SaqAI TTAA 1 cut(s) 294
SatI GCNGC 1 cut(s) 224
Sau3AI GATC 5 cut(s) 118, 184, 267, 311, 415
SchI GAGTC 1 cut(s) 17
SetI ASST 5 cut(s) 136, 151, 184, 192, 443
SfaNI GCATC 1 cut(s) 446
Sse9I AATT 5 cut(s) 78, 166, 282, 369, 448
StyI CCWWGG 1 cut(s) 419
TaaI ACNGT 3 cut(s) 18, 46, 91
TaqI TCGA 2 cut(s) 41, 454
TasI AATT 5 cut(s) 78, 166, 282, 369, 448
TfiI GAWTC 1 cut(s) 433
Tru1I TTAA 1 cut(s) 294
Tru9I TTAA 1 cut(s) 294
TseI GCWGC 1 cut(s) 223
TspDTI ATGAA 2 cut(s) 288, 389
TspGWI ACGGA 1 cut(s) 155
XapI RAATTY 1 cut(s) 166
XceI RCATGY 2 cut(s) 218, 395
XmiI GTMKAC 1 cut(s) 388
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.