Rroxscaffold_2G00149480

ubiquitin-protein transferase activity

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
OG0002220
Physical Location & Seq
Forward (+)
87030155 .. 87030604
450 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00149480.1

Sequence Viewer

Length: 450 bp
ATGGCTTCAACGGCTCCTCAACCCCTCATTGAACCACCATCACCAAGCTTGGCCCCTCAACCCCTTTTTGAACCACCATCGCCAAGCTTGGCATTTGAAGTACTCTTTTATGTGACTTTCGTACTCTATGCATTAGCCATTGCATCATTCATTGCAGTGCTTGTAGCCAAAGTAATCGAATGTTGTTTATGGATCTTGAATCGACAAACCCCTGATATGGAATCGGTGCAAGCATTACCACCTCCAACAACTCTAAAGTACAAAACCTTAAGATACTTGGGCAAGAAATTGGGTTTTGCCAGTGGTGACCAGTGTGTTATTTGCTTGATGGAGTTTGAGGAACAAGACGAGTGCGGAAAGCTTAAGTGTGAGCATACATATCACAGAGATTGCATTGAAAAGTGGCTAGCTGAGAATTCTACATGTCCTATTTGTCGCGAAAGTAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
zf-RING_2

Protein Analysis

149

Amino Acids

16.69

Weight (kDa)

5.01

Isoelectric Point (pI)

68.75

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
zf-RING_2 PF13639 103 - 146 8.2e-16 Ring finger domain
zf-rbx1 PF12678 104 - 146 1.2e-08 RING-H2 zinc finger domain
zf-RING_11 PF17123 104 - 132 7.1e-08 RING-like zinc finger
zf-C3HC4_2 PF13923 104 - 145 3.7e-07 Zinc finger, C3HC4 type (RING finger)
zf-RING_5 PF14634 104 - 146 1e-05 zinc-RING finger domain
zf-C3HC4 PF00097 105 - 145 6.9e-07 Zinc finger, C3HC4 type (RING finger)
zf-RING_UBOX PF13445 105 - 143 6.1e-07 RING-type zinc-finger
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 438
AciI CCGC 1 cut(s) 354
AclWI GGATC 1 cut(s) 200
AcsI RAATTY 1 cut(s) 415
AfaI GTAC 3 cut(s) 102, 123, 260
AfiI CCNNNNNNNGG 1 cut(s) 217
AflII CTTAAG 2 cut(s) 268, 362
AflIII ACRYGT 1 cut(s) 422
AgsI TTSAA 6 cut(s) 9, 32, 71, 98, 199, 398
AluBI AGCT 4 cut(s) 48, 87, 361, 410
AluI AGCT 4 cut(s) 48, 87, 361, 410
AlwI GGATC 1 cut(s) 200
AoxI GGCC 1 cut(s) 51
ApoI RAATTY 1 cut(s) 415
AspS9I GGNCC 1 cut(s) 52
AsuHPI GGTGA 2 cut(s) 33, 317
AsuNHI GCTAGC 1 cut(s) 406
BccI CCATC 3 cut(s) 46, 85, 322
BceAI ACGGC 1 cut(s) 27
BfaI CTAG 1 cut(s) 407
BfrI CTTAAG 2 cut(s) 268, 362
BmcAI AGTACT 1 cut(s) 102
BmgT120I GGNCC 1 cut(s) 52
BmiI GGNNCC 2 cut(s) 15, 54
BmsI GCATC 1 cut(s) 152
BmtI GCTAGC 1 cut(s) 410
Bsc4I CCNNNNNNNGG 1 cut(s) 217
Bse1I ACTGG 2 cut(s) 300, 310
Bse3DI GCAATG 2 cut(s) 138, 150
BseLI CCNNNNNNNGG 1 cut(s) 217
BseMI GCAATG 2 cut(s) 138, 150
BseMII CTCAG 1 cut(s) 402
BseNI ACTGG 2 cut(s) 300, 310
BseRI GAGGAG 1 cut(s) 6
Bsh1236I CGCG 1 cut(s) 438
BshFI GGCC 1 cut(s) 53
BslI CCNNNNNNNGG 1 cut(s) 217
BsnI GGCC 1 cut(s) 53
Bsp143I GATC 1 cut(s) 192
Bsp68I TCGCGA 1 cut(s) 438
BspACI CCGC 1 cut(s) 354
BspANI GGCC 1 cut(s) 53
BspCNI CTCAG 1 cut(s) 403
BspFNI CGCG 1 cut(s) 438
BspLI GGNNCC 2 cut(s) 15, 54
BspOI GCTAGC 1 cut(s) 410
BspPI GGATC 1 cut(s) 200
BspTI CTTAAG 2 cut(s) 268, 362
BsrDI GCAATG 2 cut(s) 138, 150
BsrI ACTGG 2 cut(s) 300, 310
BssMI GATC 1 cut(s) 192
BstAFI CTTAAG 2 cut(s) 268, 362
BstC8I GCNNGC 2 cut(s) 231, 408
BstDEI CTNAG 1 cut(s) 411
BstEII GGTNACC 1 cut(s) 305
BstFNI CGCG 1 cut(s) 438
BstKTI GATC 1 cut(s) 195
BstMBI GATC 1 cut(s) 192
BstMWI GCNNNNNNNGC 1 cut(s) 11
BstNSI RCATGY 1 cut(s) 426
BstPI GGTNACC 1 cut(s) 305
BstUI CGCG 1 cut(s) 438
BstX2I RGATCY 1 cut(s) 192
BstYI RGATCY 1 cut(s) 192
BsuRI GGCC 1 cut(s) 53
BtgZI GCGATG 1 cut(s) 63
BtsI GCAGTG 1 cut(s) 162
BtsIMutI CAGTG 3 cut(s) 162, 307, 317
BtuMI TCGCGA 1 cut(s) 438
Cac8I GCNNGC 2 cut(s) 231, 408
Cfr13I GGNCC 1 cut(s) 52
Csp6I GTAC 3 cut(s) 101, 122, 259
CviAII CATG 1 cut(s) 423
CviQI GTAC 3 cut(s) 101, 122, 259
DdeI CTNAG 1 cut(s) 411
DpnI GATC 1 cut(s) 194
DpnII GATC 1 cut(s) 192
Eco91I GGTNACC 1 cut(s) 305
EcoO65I GGTNACC 1 cut(s) 305
EcoRI GAATTC 1 cut(s) 415
EcoT22I ATGCAT 1 cut(s) 133
FaeI CATG 1 cut(s) 426
FaiI YATR 7 cut(s) 111, 129, 190, 218, 375, 379, 424
FatI CATG 1 cut(s) 422
FspBI CTAG 1 cut(s) 407
HaeIII GGCC 1 cut(s) 53
Hin1II CATG 1 cut(s) 426
HindIII AAGCTT 3 cut(s) 46, 85, 359
HinfI GANTC 2 cut(s) 199, 221
HphI GGTGA 2 cut(s) 33, 317
Hpy188III TCNNGA 2 cut(s) 196, 437
HpyCH4V TGCA 5 cut(s) 131, 143, 155, 229, 393
HpyF10VI GCNNNNNNNGC 1 cut(s) 11
HpyF3I CTNAG 1 cut(s) 411
Hsp92II CATG 1 cut(s) 426
Kzo9I GATC 1 cut(s) 192
LmnI GCTCC 1 cut(s) 19
LpnPI CCDG 3 cut(s) 225, 313, 323
LweI GCATC 1 cut(s) 152
MaeI CTAG 1 cut(s) 407
MaeIII GTNAC 2 cut(s) 112, 305
MalI GATC 1 cut(s) 194
MboI GATC 1 cut(s) 192
MflI RGATCY 1 cut(s) 192
MluCI AATT 3 cut(s) 287, 415, 445
MmeI TCCRAC 1 cut(s) 269
MnlI CCTC 5 cut(s) 27, 35, 66, 252, 331
Mph1103I ATGCAT 1 cut(s) 133
MseI TTAA 3 cut(s) 269, 363, 448
MslI CAYNNNNRTG 1 cut(s) 155
MspCI CTTAAG 2 cut(s) 268, 362
MvnI CGCG 1 cut(s) 438
MwoI GCNNNNNNNGC 1 cut(s) 11
NdeII GATC 1 cut(s) 192
NheI GCTAGC 1 cut(s) 406
NlaIII CATG 1 cut(s) 426
NlaIV GGNNCC 2 cut(s) 15, 54
NmuCI GTSAC 2 cut(s) 112, 305
NruI TCGCGA 1 cut(s) 438
NsiI ATGCAT 1 cut(s) 133
NspI RCATGY 1 cut(s) 426
PciI ACATGT 1 cut(s) 422
PfeI GAWTC 2 cut(s) 199, 221
PscI ACATGT 1 cut(s) 422
PspEI GGTNACC 1 cut(s) 305
PspN4I GGNNCC 2 cut(s) 15, 54
PspPI GGNCC 1 cut(s) 52
PsuI RGATCY 1 cut(s) 192
RruI TCGCGA 1 cut(s) 438
RsaI GTAC 3 cut(s) 102, 123, 260
RsaNI GTAC 3 cut(s) 101, 122, 259
RseI CAYNNNNRTG 1 cut(s) 155
SaqAI TTAA 3 cut(s) 269, 363, 448
Sau3AI GATC 1 cut(s) 192
Sau96I GGNCC 1 cut(s) 52
ScaI AGTACT 1 cut(s) 102
SetI ASST 6 cut(s) 50, 89, 244, 269, 363, 412
SfaNI GCATC 1 cut(s) 152
SmiMI CAYNNNNRTG 1 cut(s) 155
SmlI CTYRAG 2 cut(s) 268, 362
SmoI CTYRAG 2 cut(s) 268, 362
Sse9I AATT 3 cut(s) 287, 415, 445
SsiI CCGC 1 cut(s) 354
SspMI CTAG 1 cut(s) 407
TaqI TCGA 2 cut(s) 177, 202
TasI AATT 3 cut(s) 287, 415, 445
TatI WGTACW 2 cut(s) 100, 258
TfiI GAWTC 2 cut(s) 199, 221
Tru1I TTAA 3 cut(s) 269, 363, 448
Tru9I TTAA 3 cut(s) 269, 363, 448
TscAI CASTG 3 cut(s) 162, 307, 317
TseFI GTSAC 2 cut(s) 112, 305
Tsp45I GTSAC 2 cut(s) 112, 305
TspDTI ATGAA 1 cut(s) 139
TspRI CASTG 3 cut(s) 162, 307, 317
Vha464I CTTAAG 2 cut(s) 268, 362
XapI RAATTY 1 cut(s) 415
XceI RCATGY 1 cut(s) 426
XspI CTAG 1 cut(s) 407
ZrmI AGTACT 1 cut(s) 102
Zsp2I ATGCAT 1 cut(s) 133
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.