MD00G1179600.v1.1

Catalytic histone acetyltransferase subunit of the RNA polymerase II elongator complex, which is a component of the RNA polymerase II (Pol II) holoenzyme and is involved in transcriptional elongation

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr00
Physical Location & Seq
Reverse (-)
42176145 .. 42176573
429 bp
Loading structure...
UTR
Exon/CDS
Intron
MD00G1179600.v1.1.491

Sequence Viewer

Length: 225 bp
ATGGCTTTCTCTAGTTCATTGACGCATTTTATCGAACACTTGATAGGGAATTCCAGTTTTATATACAACCCATATGTCCAGGCTAGAAGCAGGATAGATCAGCTGAAGAGATTGGGTCACAGTGTAGACAAGGTTTGGTCTGTTCTATGTTTAGAGCTTAAAGAGTTTATTTTCGGGTTTGCAGATTTCCATGATAGAGTAATATGCATAGTTGTCGCCTTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

75

Amino Acids

8.53

Weight (kDa)

6.89

Isoelectric Point (pI)

25.92

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 223
AccI GTMKAC 1 cut(s) 126
AcsI RAATTY 1 cut(s) 49
AcuI CTGAAG 1 cut(s) 125
AjnI CCWGG 1 cut(s) 78
AluBI AGCT 2 cut(s) 103, 157
AluI AGCT 2 cut(s) 103, 157
ApoI RAATTY 1 cut(s) 49
BcgI CGANNNNNNTGC 1 cut(s) 196
BciT130I CCWGG 1 cut(s) 80
BfaI CTAG 2 cut(s) 12, 84
Bme1390I CCNGG 1 cut(s) 80
BmrFI CCNGG 1 cut(s) 80
Bse1I ACTGG 1 cut(s) 54
BseBI CCWGG 1 cut(s) 80
BseNI ACTGG 1 cut(s) 54
Bsp143I GATC 1 cut(s) 97
BsrI ACTGG 1 cut(s) 54
BssMI GATC 1 cut(s) 97
Bst2UI CCWGG 1 cut(s) 80
Bst4CI ACNGT 1 cut(s) 122
Bst6I CTCTTC 1 cut(s) 101
BstKTI GATC 1 cut(s) 100
BstMBI GATC 1 cut(s) 97
BstNI CCWGG 1 cut(s) 80
BstSCI CCNGG 1 cut(s) 78
BtsIMutI CAGTG 1 cut(s) 127
CseI GACGC 1 cut(s) 31
CviAII CATG 1 cut(s) 191
CviJI RGCY 4 cut(s) 5, 83, 103, 157
CviKI_1 RGCY 4 cut(s) 5, 83, 103, 157
DpnI GATC 1 cut(s) 99
DpnII GATC 1 cut(s) 97
Eam1104I CTCTTC 1 cut(s) 101
EarI CTCTTC 1 cut(s) 101
Eco57I CTGAAG 1 cut(s) 125
EcoRI GAATTC 1 cut(s) 49
EcoRII CCWGG 1 cut(s) 78
EcoT22I ATGCAT 1 cut(s) 209
FaeI CATG 1 cut(s) 194
FaiI YATR 9 cut(s) 62, 64, 73, 75, 148, 192, 205, 209, 223
FatI CATG 1 cut(s) 190
FauNDI CATATG 1 cut(s) 73
FblI GTMKAC 1 cut(s) 126
FspBI CTAG 2 cut(s) 12, 84
HgaI GACGC 1 cut(s) 31
Hin1II CATG 1 cut(s) 194
Hpy166II GTNNAC 1 cut(s) 127
Hpy8I GTNNAC 1 cut(s) 127
HpyCH4III ACNGT 1 cut(s) 122
HpyCH4V TGCA 2 cut(s) 182, 207
Hsp92II CATG 1 cut(s) 194
Kzo9I GATC 1 cut(s) 97
LpnPI CCDG 4 cut(s) 65, 67, 76, 92
MaeI CTAG 2 cut(s) 12, 84
MaeIII GTNAC 1 cut(s) 116
MalI GATC 1 cut(s) 99
MboI GATC 1 cut(s) 97
MboII GAAGA 1 cut(s) 118
MluCI AATT 1 cut(s) 49
Mph1103I ATGCAT 1 cut(s) 209
MseI TTAA 1 cut(s) 159
MspA1I CMGCKG 1 cut(s) 103
MspR9I CCNGG 1 cut(s) 80
MvaI CCWGG 1 cut(s) 80
NdeI CATATG 1 cut(s) 73
NdeII GATC 1 cut(s) 97
NlaIII CATG 1 cut(s) 194
NmuCI GTSAC 1 cut(s) 116
NsiI ATGCAT 1 cut(s) 209
PsiI TTATAA 1 cut(s) 223
Psp6I CCWGG 1 cut(s) 78
PspGI CCWGG 1 cut(s) 78
PvuII CAGCTG 1 cut(s) 103
SaqAI TTAA 1 cut(s) 159
Sau3AI GATC 1 cut(s) 97
ScrFI CCNGG 1 cut(s) 80
SetI ASST 3 cut(s) 105, 135, 159
Sse9I AATT 1 cut(s) 49
SspMI CTAG 2 cut(s) 12, 84
StyD4I CCNGG 1 cut(s) 78
TaaI ACNGT 1 cut(s) 122
TaqI TCGA 1 cut(s) 33
TasI AATT 1 cut(s) 49
Tru1I TTAA 1 cut(s) 159
Tru9I TTAA 1 cut(s) 159
TscAI CASTG 1 cut(s) 127
TseFI GTSAC 1 cut(s) 116
Tsp45I GTSAC 1 cut(s) 116
TspDTI ATGAA 1 cut(s) 6
TspRI CASTG 1 cut(s) 127
XapI RAATTY 1 cut(s) 49
XmiI GTMKAC 1 cut(s) 126
XspI CTAG 2 cut(s) 12, 84
Zsp2I ATGCAT 1 cut(s) 209
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.