MD06G1155500.v1.1

Catalytic histone acetyltransferase subunit of the RNA polymerase II elongator complex, which is a component of the RNA polymerase II (Pol II) holoenzyme and is involved in transcriptional elongation

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr06
OG0001670
Physical Location & Seq
Forward (+)
29805206 .. 29805457
252 bp
Loading structure...
UTR
Exon/CDS
Intron
MD06G1155500.v1.1.491

Sequence Viewer

Length: 252 bp
ATGATTTGTTTTTGTTCTTTTTGTAAACAGGATATTCTAGCTGGGTTACCGCGATTAAGAAAGTGTGGCCGGAACACTACTTGTCCCGAACTCATAGGAAAGTGTTCTATTGTTCGTGAACTCCACGTTCATGGGACTGCTGTTCCAGTTCATGGGTGGTGGTATCCACACTTCTCTTTTATCTTTCTCTTTCCTCTTAATTTCCATCTGTCAGATCGAATGTATAAAAAAAGATTAAATGATAGAAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

84

Amino Acids

9.78

Weight (kDa)

9.45

Isoelectric Point (pI)

33.74

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 152
AccII CGCG 1 cut(s) 52
AciI CCGC 1 cut(s) 50
AcoI YGGCCR 1 cut(s) 67
AfiI CCNNNNNNNGG 1 cut(s) 152
AluBI AGCT 1 cut(s) 41
AluI AGCT 1 cut(s) 41
AoxI GGCC 1 cut(s) 67
Asp700I GAANNNNTTC 1 cut(s) 103
BarI GAAGNNNNNNTAC 2 cut(s) 155, 187
BccI CCATC 1 cut(s) 213
BciVI GTATCC 1 cut(s) 174
BfaI CTAG 1 cut(s) 38
BfuI GTATCC 1 cut(s) 174
Bsc4I CCNNNNNNNGG 1 cut(s) 152
Bse1I ACTGG 1 cut(s) 146
BseLI CCNNNNNNNGG 1 cut(s) 152
BseNI ACTGG 1 cut(s) 146
BseYI CCCAGC 1 cut(s) 41
Bsh1236I CGCG 1 cut(s) 52
BshFI GGCC 1 cut(s) 69
BsiSI CCGG 1 cut(s) 70
BslFI GGGAC 2 cut(s) 69, 148
BslI CCNNNNNNNGG 1 cut(s) 152
BsmFI GGGAC 2 cut(s) 69, 148
BsnI GGCC 1 cut(s) 69
Bsp143I GATC 1 cut(s) 214
BspACI CCGC 1 cut(s) 50
BspANI GGCC 1 cut(s) 69
BspFNI CGCG 1 cut(s) 52
BsrI ACTGG 1 cut(s) 146
BssMI GATC 1 cut(s) 214
BstEII GGTNACC 1 cut(s) 45
BstFNI CGCG 1 cut(s) 52
BstKTI GATC 1 cut(s) 217
BstMBI GATC 1 cut(s) 214
BstPI GGTNACC 1 cut(s) 45
BstUI CGCG 1 cut(s) 52
BstXI CCANNNNNNTGG 1 cut(s) 131
BsuI GTATCC 1 cut(s) 174
BsuRI GGCC 1 cut(s) 69
CviAII CATG 2 cut(s) 131, 152
CviJI RGCY 2 cut(s) 41, 69
CviKI_1 RGCY 2 cut(s) 41, 69
DpnI GATC 1 cut(s) 216
DpnII GATC 1 cut(s) 214
EaeI YGGCCR 1 cut(s) 67
Eco91I GGTNACC 1 cut(s) 45
EcoO65I GGTNACC 1 cut(s) 45
FaeI CATG 2 cut(s) 134, 155
FaiI YATR 4 cut(s) 95, 132, 153, 225
FaqI GGGAC 2 cut(s) 69, 148
FatI CATG 2 cut(s) 130, 151
FspBI CTAG 1 cut(s) 38
GsaI CCCAGC 1 cut(s) 45
HaeIII GGCC 1 cut(s) 69
HapII CCGG 1 cut(s) 70
Hin1II CATG 2 cut(s) 134, 155
HpaII CCGG 1 cut(s) 70
Hpy166II GTNNAC 2 cut(s) 26, 119
Hpy188I TCNGA 1 cut(s) 214
Hpy188III TCNNGA 2 cut(s) 86, 116
Hpy8I GTNNAC 2 cut(s) 26, 119
HpyCH4IV ACGT 1 cut(s) 126
HpySE526I ACGT 1 cut(s) 126
Hsp92II CATG 2 cut(s) 134, 155
Kzo9I GATC 1 cut(s) 214
LpnPI CCDG 4 cut(s) 14, 27, 83, 159
MaeI CTAG 1 cut(s) 38
MaeII ACGT 1 cut(s) 126
MaeIII GTNAC 1 cut(s) 45
MalI GATC 1 cut(s) 216
MboI GATC 1 cut(s) 214
MluCI AATT 2 cut(s) 199, 247
MnlI CCTC 1 cut(s) 204
MroXI GAANNNNTTC 1 cut(s) 103
MseI TTAA 4 cut(s) 56, 198, 236, 250
MslI CAYNNNNRTG 1 cut(s) 129
MspI CCGG 1 cut(s) 70
MvnI CGCG 1 cut(s) 52
NdeII GATC 1 cut(s) 214
NlaIII CATG 2 cut(s) 134, 155
PdmI GAANNNNTTC 1 cut(s) 103
PflMI CCANNNNNTGG 1 cut(s) 152
PspEI GGTNACC 1 cut(s) 45
PspFI CCCAGC 1 cut(s) 41
RseI CAYNNNNRTG 1 cut(s) 129
SaqAI TTAA 4 cut(s) 56, 198, 236, 250
Sau3AI GATC 1 cut(s) 214
SetI ASST 2 cut(s) 43, 129
SmiMI CAYNNNNRTG 1 cut(s) 129
Sse9I AATT 2 cut(s) 199, 247
SsiI CCGC 1 cut(s) 50
SspMI CTAG 1 cut(s) 38
TaiI ACGT 1 cut(s) 129
TaqI TCGA 1 cut(s) 217
TasI AATT 2 cut(s) 199, 247
Tru1I TTAA 4 cut(s) 56, 198, 236, 250
Tru9I TTAA 4 cut(s) 56, 198, 236, 250
TspDTI ATGAA 2 cut(s) 119, 140
Van91I CCANNNNNTGG 1 cut(s) 152
XcmI CCANNNNNNNNNTGG 1 cut(s) 153
XmnI GAANNNNTTC 1 cut(s) 103
XspI CTAG 1 cut(s) 38
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.