MD04G1182800.v1.1

No description available

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr04
Physical Location & Seq
Reverse (-)
27398213 .. 27399088
876 bp
Loading structure...
UTR
Exon/CDS
Intron
MD04G1182800.v1.1.491

Sequence Viewer

Length: 183 bp
ATGAGCCTGTGGTTCCAACAAGTCATGGAAGTCGAAGATCATGATGACGGCGACAAAGAACAACACCATCAAGAACAAGATGAAATGGAGGCACGTCACCCGCTGATCAGGATGCTAATCAGGACACTAACTCTGTCAGCGCTGCTGAGGATGATTGCGAGAGAAAATTTGAAGAATCAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

61

Amino Acids

7.26

Weight (kDa)

5.16

Isoelectric Point (pI)

40.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 101
AcsI RAATTY 1 cut(s) 166
AfeI AGCGCT 1 cut(s) 141
AgsI TTSAA 1 cut(s) 172
AjiI CACGTC 1 cut(s) 95
Aor51HI AGCGCT 1 cut(s) 141
ApeKI GCWGC 1 cut(s) 142
ApoI RAATTY 1 cut(s) 166
AspLEI GCGC 1 cut(s) 142
AsuHPI GGTGA 1 cut(s) 89
BbvCI CCTCAGC 1 cut(s) 146
BbvI GCAGC 1 cut(s) 129
BccI CCATC 1 cut(s) 75
BceAI ACGGC 1 cut(s) 64
BclI TGATCA 1 cut(s) 105
BfoI RGCGCY 1 cut(s) 143
BisI GCNGC 1 cut(s) 143
BlsI GCNGC 1 cut(s) 144
BmgBI CACGTC 1 cut(s) 95
BmiI GGNNCC 1 cut(s) 14
BmsI GCATC 1 cut(s) 102
Bpu10I CCTNAGC 1 cut(s) 146
BsaBI GATNNNNATC 1 cut(s) 116
Bse8I GATNNNNATC 1 cut(s) 116
BseGI GGATG 2 cut(s) 117, 156
BseJI GATNNNNATC 1 cut(s) 116
BseMII CTCAG 1 cut(s) 137
BseXI GCAGC 1 cut(s) 129
Bsp143I GATC 2 cut(s) 37, 105
BspACI CCGC 1 cut(s) 101
BspCNI CTCAG 1 cut(s) 138
BspHI TCATGA 1 cut(s) 40
BspLI GGNNCC 1 cut(s) 14
BssMI GATC 2 cut(s) 37, 105
BstDEI CTNAG 1 cut(s) 146
BstF5I GGATG 2 cut(s) 117, 156
BstH2I RGCGCY 1 cut(s) 143
BstHHI GCGC 1 cut(s) 142
BstKTI GATC 2 cut(s) 40, 108
BstMBI GATC 2 cut(s) 37, 105
BstV1I GCAGC 1 cut(s) 129
BtrI CACGTC 1 cut(s) 95
BtsCI GGATG 2 cut(s) 117, 156
CciI TCATGA 1 cut(s) 40
CfoI GCGC 1 cut(s) 142
CviAII CATG 2 cut(s) 25, 41
CviJI RGCY 1 cut(s) 6
CviKI_1 RGCY 1 cut(s) 6
DdeI CTNAG 1 cut(s) 146
DpnI GATC 2 cut(s) 39, 107
DpnII GATC 2 cut(s) 37, 105
Eco47III AGCGCT 1 cut(s) 141
FaeI CATG 2 cut(s) 28, 44
FaiI YATR 2 cut(s) 26, 42
FatI CATG 2 cut(s) 24, 40
FauI CCCGC 1 cut(s) 108
FbaI TGATCA 1 cut(s) 105
Fnu4HI GCNGC 1 cut(s) 143
FokI GGATG 2 cut(s) 124, 163
Fsp4HI GCNGC 1 cut(s) 143
GlaI GCGC 1 cut(s) 141
GluI GCNGC 1 cut(s) 143
HaeII RGCGCY 1 cut(s) 143
HhaI GCGC 1 cut(s) 142
Hin1II CATG 2 cut(s) 28, 44
Hin6I GCGC 1 cut(s) 140
HinP1I GCGC 1 cut(s) 140
HinfI GANTC 1 cut(s) 175
HphI GGTGA 1 cut(s) 89
Hpy188III TCNNGA 4 cut(s) 41, 71, 109, 121
HpyCH4IV ACGT 1 cut(s) 94
HpyF3I CTNAG 1 cut(s) 146
HpySE526I ACGT 1 cut(s) 94
Hsp92II CATG 2 cut(s) 28, 44
HspAI GCGC 1 cut(s) 140
Ksp22I TGATCA 1 cut(s) 105
Kzo9I GATC 2 cut(s) 37, 105
LpnPI CCDG 3 cut(s) 20, 94, 106
Lsp1109I GCAGC 1 cut(s) 129
LweI GCATC 1 cut(s) 102
MaeII ACGT 1 cut(s) 94
MaeIII GTNAC 1 cut(s) 95
MalI GATC 2 cut(s) 39, 107
MboI GATC 2 cut(s) 37, 105
MboII GAAGA 1 cut(s) 47
MluCI AATT 1 cut(s) 166
MmeI TCCRAC 1 cut(s) 40
MnlI CCTC 2 cut(s) 82, 141
MspA1I CMGCKG 1 cut(s) 103
NdeII GATC 2 cut(s) 37, 105
NlaIII CATG 2 cut(s) 28, 44
NlaIV GGNNCC 1 cut(s) 14
NmuCI GTSAC 1 cut(s) 95
PagI TCATGA 1 cut(s) 40
PfeI GAWTC 1 cut(s) 175
PkrI GCNGC 1 cut(s) 144
PspN4I GGNNCC 1 cut(s) 14
SatI GCNGC 1 cut(s) 143
Sau3AI GATC 2 cut(s) 37, 105
SetI ASST 1 cut(s) 97
SfaNI GCATC 1 cut(s) 102
Sse9I AATT 1 cut(s) 166
SsiI CCGC 1 cut(s) 101
TaiI ACGT 1 cut(s) 97
TaqI TCGA 1 cut(s) 33
TasI AATT 1 cut(s) 166
TfiI GAWTC 1 cut(s) 175
TseFI GTSAC 1 cut(s) 95
TseI GCWGC 1 cut(s) 142
Tsp45I GTSAC 1 cut(s) 95
TspDTI ATGAA 1 cut(s) 96
XapI RAATTY 1 cut(s) 166
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.