RchiOBHm_Chr6g0283071

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Reverse (-)
46296781 .. 46303108
6328 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ25379

Sequence Viewer

Length: 249 bp
ATGAAGGGTCGCCTGAAAGAGATGAGTGAGTGGTGCAGGCAACTCATGCGTGAAGAAGATTTGGAACAAGATGAAGAACTTGAAACTGGAGTTACTCAAGACATTCCTGACATTGATGCCACTCAAGATATTCCCAATGATACTTTTACTGAGTTGTCGGTTGCTTCTTCCCGGCAGAAGTTGAAGTCCAAAGCCTGCTACATGAACATTGAGTTTTATTCTCGCCCTTTCTCACTCCAATGGCATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

82

Amino Acids

9.72

Weight (kDa)

4.57

Isoelectric Point (pI)

75.59

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 2 cut(s) 83, 184
AsuC2I CCSGG 1 cut(s) 172
BcnI CCSGG 1 cut(s) 172
Bme1390I CCNGG 1 cut(s) 172
BmrFI CCNGG 1 cut(s) 172
BmsI GCATC 1 cut(s) 106
BpmI CTGGAG 1 cut(s) 108
BpuEI CTTGAG 2 cut(s) 81, 108
BpuMI CCSGG 1 cut(s) 172
Bse1I ACTGG 1 cut(s) 91
BseMII CTCAG 1 cut(s) 141
BseNI ACTGG 1 cut(s) 91
BsgI GTGCAG 1 cut(s) 55
BsiSI CCGG 1 cut(s) 172
BspCNI CTCAG 1 cut(s) 142
BsrI ACTGG 1 cut(s) 91
BstAPI GCANNNNNTGC 1 cut(s) 46
BstC8I GCNNGC 2 cut(s) 38, 196
BstDEI CTNAG 1 cut(s) 150
BstMWI GCNNNNNNNGC 1 cut(s) 46
BstSCI CCNGG 1 cut(s) 170
Cac8I GCNNGC 2 cut(s) 38, 196
CviAII CATG 2 cut(s) 46, 202
CviJI RGCY 1 cut(s) 194
CviKI_1 RGCY 1 cut(s) 194
DdeI CTNAG 1 cut(s) 150
FaeI CATG 2 cut(s) 49, 205
FaiI YATR 2 cut(s) 47, 203
FatI CATG 2 cut(s) 45, 201
GsuI CTGGAG 1 cut(s) 108
HapII CCGG 1 cut(s) 172
Hin1II CATG 2 cut(s) 49, 205
HpaII CCGG 1 cut(s) 172
Hpy188III TCNNGA 3 cut(s) 98, 107, 125
HpyCH4V TGCA 1 cut(s) 36
HpyF10VI GCNNNNNNNGC 1 cut(s) 46
HpyF3I CTNAG 1 cut(s) 150
Hsp92II CATG 2 cut(s) 49, 205
LpnPI CCDG 6 cut(s) 22, 26, 72, 120, 185, 208
LweI GCATC 1 cut(s) 106
MaeIII GTNAC 1 cut(s) 91
MboII GAAGA 4 cut(s) 65, 68, 86, 159
MslI CAYNNNNRTG 1 cut(s) 238
MspI CCGG 1 cut(s) 172
MspR9I CCNGG 1 cut(s) 172
MwoI GCNNNNNNNGC 1 cut(s) 46
NciI CCSGG 1 cut(s) 172
NlaIII CATG 2 cut(s) 49, 205
RseI CAYNNNNRTG 1 cut(s) 238
ScrFI CCNGG 1 cut(s) 172
SfaNI GCATC 1 cut(s) 106
SmiMI CAYNNNNRTG 1 cut(s) 238
SmlI CTYRAG 2 cut(s) 96, 123
SmoI CTYRAG 2 cut(s) 96, 123
StyD4I CCNGG 1 cut(s) 170
TspDTI ATGAA 3 cut(s) 17, 87, 218
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.