MD08G1079500.v1.1

No description available

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr08
Physical Location & Seq
Reverse (-)
6612250 .. 6612943
694 bp
Loading structure...
UTR
Exon/CDS
Intron
MD08G1079500.v1.1.491

Sequence Viewer

Length: 360 bp
ATGGCATCTAGATTCGTGAACTTTTCTCTGTTGGTTTTCGTTTGCAGTCTCATTGTAGGAGGATATTGCCAACCCTGCACGTTAGACAATCTTAAAATTGCCCAAGGAAAGATTAGCGATGTCAAGTGGCATGTAACAATCACTAATGACTGTCTATGTTCTCAACAGGATGTGAAGCTTAGTTGCGATGGGTTTCAGTCTGCAGAACCCATTGATCCTTCAATTTTGTCAAAATCTGGTGGCGAGTGTTTGGTCAATAATGGTCAACCAATCTATGGAAATAAAAATTTCAATTTTGATTATGCTTCGACAACTAAGTTTCCTTTCAAGCCACTCTCTTCCCAAGTTGCTTGTTCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

120

Amino Acids

12.95

Weight (kDa)

6.51

Isoelectric Point (pI)

43.41

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
TPD1_C PF24068 40 - 117 1.1e-26 Tapetum determinant 1, C-terminal
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 275
AclWI GGATC 1 cut(s) 209
AcsI RAATTY 1 cut(s) 286
AfiI CCNNNNNNNGG 1 cut(s) 275
AgsI TTSAA 3 cut(s) 222, 292, 328
AluBI AGCT 1 cut(s) 178
AluI AGCT 1 cut(s) 178
Alw26I GTCTC 1 cut(s) 53
AlwI GGATC 1 cut(s) 209
ApoI RAATTY 1 cut(s) 286
BccI CCATC 1 cut(s) 182
BcoDI GTCTC 1 cut(s) 53
BfaI CTAG 1 cut(s) 9
BfmI CTRYAG 1 cut(s) 201
BmsI GCATC 1 cut(s) 14
BsaJI CCNNGG 1 cut(s) 103
Bsc4I CCNNNNNNNGG 1 cut(s) 275
BseDI CCNNGG 1 cut(s) 103
BseGI GGATG 1 cut(s) 175
BseLI CCNNNNNNNGG 1 cut(s) 275
BsgI GTGCAG 1 cut(s) 61
BslI CCNNNNNNNGG 1 cut(s) 275
BsmAI GTCTC 1 cut(s) 53
Bsp143I GATC 1 cut(s) 214
BspMAI CTGCAG 1 cut(s) 205
BspPI GGATC 1 cut(s) 209
BssECI CCNNGG 1 cut(s) 103
BssMI GATC 1 cut(s) 214
BssT1I CCWWGG 1 cut(s) 103
Bst4CI ACNGT 1 cut(s) 152
Bst6I CTCTTC 1 cut(s) 343
BstDEI CTNAG 2 cut(s) 179, 315
BstF5I GGATG 1 cut(s) 175
BstKTI GATC 1 cut(s) 217
BstMAI GTCTC 1 cut(s) 53
BstMBI GATC 1 cut(s) 214
BstMWI GCNNNNNNNGC 1 cut(s) 75
BstNSI RCATGY 1 cut(s) 134
BstSFI CTRYAG 1 cut(s) 201
BtgZI GCGATG 2 cut(s) 132, 201
BtsCI GGATG 1 cut(s) 175
CviAII CATG 1 cut(s) 131
CviJI RGCY 2 cut(s) 178, 331
CviKI_1 RGCY 2 cut(s) 178, 331
DdeI CTNAG 2 cut(s) 179, 315
DpnI GATC 1 cut(s) 216
DpnII GATC 1 cut(s) 214
Eam1104I CTCTTC 1 cut(s) 343
EarI CTCTTC 1 cut(s) 343
Eco130I CCWWGG 1 cut(s) 103
EcoT14I CCWWGG 1 cut(s) 103
ErhI CCWWGG 1 cut(s) 103
FaeI CATG 1 cut(s) 134
FaiI YATR 4 cut(s) 132, 157, 276, 303
FatI CATG 1 cut(s) 130
FokI GGATG 1 cut(s) 182
FspBI CTAG 1 cut(s) 9
Hin1II CATG 1 cut(s) 134
HincII GTYRAC 1 cut(s) 266
HindII GTYRAC 1 cut(s) 266
HindIII AAGCTT 1 cut(s) 176
HinfI GANTC 1 cut(s) 12
Hpy166II GTNNAC 2 cut(s) 19, 266
Hpy188III TCNNGA 3 cut(s) 9, 16, 357
Hpy8I GTNNAC 2 cut(s) 19, 266
HpyAV CCTTC 1 cut(s) 228
HpyCH4III ACNGT 1 cut(s) 152
HpyCH4IV ACGT 1 cut(s) 80
HpyCH4V TGCA 3 cut(s) 45, 78, 203
HpyF10VI GCNNNNNNNGC 1 cut(s) 75
HpyF3I CTNAG 2 cut(s) 179, 315
HpySE526I ACGT 1 cut(s) 80
Hsp92II CATG 1 cut(s) 134
Kzo9I GATC 1 cut(s) 214
LpnPI CCDG 3 cut(s) 88, 152, 222
LweI GCATC 1 cut(s) 14
MaeI CTAG 1 cut(s) 9
MaeII ACGT 1 cut(s) 80
MaeIII GTNAC 1 cut(s) 133
MalI GATC 1 cut(s) 216
MboI GATC 1 cut(s) 214
MboII GAAGA 1 cut(s) 330
MluCI AATT 4 cut(s) 96, 222, 286, 292
MnlI CCTC 1 cut(s) 53
MseI TTAA 1 cut(s) 93
MwoI GCNNNNNNNGC 1 cut(s) 75
NdeII GATC 1 cut(s) 214
NlaIII CATG 1 cut(s) 134
NspI RCATGY 1 cut(s) 134
PfeI GAWTC 1 cut(s) 12
PflMI CCANNNNNTGG 1 cut(s) 275
PstI CTGCAG 1 cut(s) 205
SaqAI TTAA 1 cut(s) 93
Sau3AI GATC 1 cut(s) 214
SetI ASST 2 cut(s) 83, 180
SfaNI GCATC 1 cut(s) 14
SfcI CTRYAG 1 cut(s) 201
Sse9I AATT 4 cut(s) 96, 222, 286, 292
SspMI CTAG 1 cut(s) 9
StyI CCWWGG 1 cut(s) 103
TaaI ACNGT 1 cut(s) 152
TaiI ACGT 1 cut(s) 83
TaqI TCGA 1 cut(s) 308
TasI AATT 4 cut(s) 96, 222, 286, 292
TfiI GAWTC 1 cut(s) 12
Tru1I TTAA 1 cut(s) 93
Tru9I TTAA 1 cut(s) 93
Van91I CCANNNNNTGG 1 cut(s) 275
XapI RAATTY 1 cut(s) 286
XbaI TCTAGA 1 cut(s) 8
XceI RCATGY 1 cut(s) 134
XspI CTAG 1 cut(s) 9
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.