Rh6CG296400

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
Physical Location & Seq
Forward (+)
47738273 .. 47738843
571 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG296400.1

Sequence Viewer

Length: 288 bp
ATGGCACCAATTCTGAAGTTTCTCAGCCTGGCTTTGATTTTCAGTGTGATTGTAGGAGTGGACTGTAAGTGCTCTAAGAACAGGCTCAAAGTCACACAGTATCGAACAGGAGAGTTGTTGCTCACCAAGCCAGTGTGGAGGGTGAAGATCACCAATGACTGCCCCTCTACTCAACTCGATGTTAAACTAAGTTGCAAGGGATTTCAAGCCGTGCAAGATATTGGTCCTAAGCCAATCTTGGCCAAATCCGGTGGCGAGTGTCTCCTCAACGATCGAGCTTCCAAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

95

Amino Acids

10.42

Weight (kDa)

9.54

Isoelectric Point (pI)

15.93

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
TPD1_C PF24068 26 - 91 1.2e-14 Tapetum determinant 1, C-terminal
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 4
AcoI YGGCCR 1 cut(s) 240
AcuI CTGAAG 1 cut(s) 35
AgsI TTSAA 1 cut(s) 206
AjnI CCWGG 1 cut(s) 27
AluBI AGCT 1 cut(s) 278
AluI AGCT 1 cut(s) 278
Alw21I GWGCWC 1 cut(s) 74
Alw26I GTCTC 1 cut(s) 266
AoxI GGCC 1 cut(s) 240
AspS9I GGNCC 1 cut(s) 224
AsuHPI GGTGA 3 cut(s) 115, 142, 154
AvaII GGWCC 1 cut(s) 224
BalI TGGCCA 1 cut(s) 242
BanI GGYRCC 1 cut(s) 4
Bbv12I GWGCWC 1 cut(s) 74
BceAI ACGGC 1 cut(s) 194
BciT130I CCWGG 1 cut(s) 29
BcoDI GTCTC 1 cut(s) 266
Bme1390I CCNGG 1 cut(s) 29
Bme18I GGWCC 1 cut(s) 224
BmgT120I GGNCC 1 cut(s) 224
BmiI GGNNCC 1 cut(s) 6
BmrFI CCNGG 1 cut(s) 29
Bpu10I CCTNAGC 1 cut(s) 228
BsaWI WCCGGW 1 cut(s) 248
Bse1I ACTGG 1 cut(s) 131
BseBI CCWGG 1 cut(s) 29
BseMII CTCAG 1 cut(s) 37
BseNI ACTGG 1 cut(s) 131
BseRI GAGGAG 1 cut(s) 254
Bsh1285I CGRYCG 1 cut(s) 274
BshFI GGCC 1 cut(s) 242
BshNI GGYRCC 1 cut(s) 4
BsiEI CGRYCG 1 cut(s) 274
BsiHKAI GWGCWC 1 cut(s) 74
BsiSI CCGG 1 cut(s) 249
BsmAI GTCTC 1 cut(s) 266
BsnI GGCC 1 cut(s) 242
Bsp1286I GDGCHC 1 cut(s) 74
Bsp143I GATC 2 cut(s) 147, 271
BspANI GGCC 1 cut(s) 242
BspCNI CTCAG 1 cut(s) 36
BspLI GGNNCC 1 cut(s) 6
BspT107I GGYRCC 1 cut(s) 4
BsrI ACTGG 1 cut(s) 131
BssMI GATC 2 cut(s) 147, 271
Bst2UI CCWGG 1 cut(s) 29
Bst4CI ACNGT 2 cut(s) 65, 99
BstDEI CTNAG 4 cut(s) 23, 75, 188, 228
BstKTI GATC 2 cut(s) 150, 274
BstMAI GTCTC 1 cut(s) 266
BstMBI GATC 2 cut(s) 147, 271
BstMCI CGRYCG 1 cut(s) 274
BstMWI GCNNNNNNNGC 1 cut(s) 127
BstNI CCWGG 1 cut(s) 29
BstSCI CCNGG 1 cut(s) 27
BsuRI GGCC 1 cut(s) 242
BtsIMutI CAGTG 2 cut(s) 49, 138
Cfr13I GGNCC 1 cut(s) 224
CspCI CAANNNNNGTGG 2 cut(s) 232, 267
CviJI RGCY 8 cut(s) 27, 32, 85, 130, 209, 232, 242, 278
CviKI_1 RGCY 8 cut(s) 27, 32, 85, 130, 209, 232, 242, 278
DdeI CTNAG 4 cut(s) 23, 75, 188, 228
DpnI GATC 2 cut(s) 149, 273
DpnII GATC 2 cut(s) 147, 271
EaeI YGGCCR 1 cut(s) 240
Eco47I GGWCC 1 cut(s) 224
Eco57I CTGAAG 1 cut(s) 35
EcoRII CCWGG 1 cut(s) 27
FalI AAGNNNNNCTT 2 cut(s) 221, 253
HaeIII GGCC 1 cut(s) 242
HapII CCGG 1 cut(s) 249
HpaII CCGG 1 cut(s) 249
HphI GGTGA 3 cut(s) 115, 142, 154
Hpy166II GTNNAC 1 cut(s) 61
Hpy188I TCNGA 1 cut(s) 15
Hpy8I GTNNAC 1 cut(s) 61
HpyCH4III ACNGT 2 cut(s) 65, 99
HpyCH4V TGCA 2 cut(s) 195, 214
HpyF10VI GCNNNNNNNGC 1 cut(s) 127
HpyF3I CTNAG 4 cut(s) 23, 75, 188, 228
Kzo9I GATC 2 cut(s) 147, 271
LpnPI CCDG 6 cut(s) 14, 41, 67, 93, 144, 262
MaeIII GTNAC 1 cut(s) 91
MalI GATC 2 cut(s) 149, 273
MboI GATC 2 cut(s) 147, 271
MboII GAAGA 1 cut(s) 157
MhlI GDGCHC 1 cut(s) 74
MlsI TGGCCA 1 cut(s) 242
MluCI AATT 1 cut(s) 9
MluNI TGGCCA 1 cut(s) 242
MnlI CCTC 3 cut(s) 132, 175, 275
Mox20I TGGCCA 1 cut(s) 242
MscI TGGCCA 1 cut(s) 242
MseI TTAA 1 cut(s) 183
Msp20I TGGCCA 1 cut(s) 242
MspI CCGG 1 cut(s) 249
MspR9I CCNGG 1 cut(s) 29
MvaI CCWGG 1 cut(s) 29
MwoI GCNNNNNNNGC 1 cut(s) 127
NdeII GATC 2 cut(s) 147, 271
NlaIV GGNNCC 1 cut(s) 6
NmuCI GTSAC 1 cut(s) 91
Ple19I CGATCG 1 cut(s) 274
Psp6I CCWGG 1 cut(s) 27
PspGI CCWGG 1 cut(s) 27
PspN4I GGNNCC 1 cut(s) 6
PspPI GGNCC 1 cut(s) 224
PvuI CGATCG 1 cut(s) 274
SaqAI TTAA 1 cut(s) 183
Sau3AI GATC 2 cut(s) 147, 271
Sau96I GGNCC 1 cut(s) 224
ScrFI CCNGG 1 cut(s) 29
SduI GDGCHC 1 cut(s) 74
SetI ASST 1 cut(s) 280
SinI GGWCC 1 cut(s) 224
Sse9I AATT 1 cut(s) 9
StyD4I CCNGG 1 cut(s) 27
TaaI ACNGT 2 cut(s) 65, 99
TaqI TCGA 3 cut(s) 103, 177, 274
TasI AATT 1 cut(s) 9
Tru1I TTAA 1 cut(s) 183
Tru9I TTAA 1 cut(s) 183
TscAI CASTG 2 cut(s) 49, 138
TseFI GTSAC 1 cut(s) 91
Tsp45I GTSAC 1 cut(s) 91
TspRI CASTG 2 cut(s) 49, 138
VpaK11BI GGWCC 1 cut(s) 224
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.