RchiOBHm_Chr6g0297491

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
OG0001875
Physical Location & Seq
Reverse (-)
59220552 .. 59220785
234 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ26701

Sequence Viewer

Length: 234 bp
ATGGAATTAAAGATCACTAACAACTGCATTTGTTCTCAATTGAGTGTTAAGTTGAGTTGTGATGGCTTTCAAACTGTGGAAGAGATTGATCCTACAATCTTGAGCAAATCTGGTAGCTTGTGTCTTGTCAACAGTGGCGAACCTATCTATGGGCATAGCAATTTCAGTTTCACCTATGCGTGGAGCAATTCGTTTCCTTTCAAAACGCTGCTCTCTCAAGTTGCTTGTTCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

77

Amino Acids

8.43

Weight (kDa)

5.0

Isoelectric Point (pI)

36.66

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
TPD1_C PF24068 3 - 76 1.9e-22 Tapetum determinant 1, C-terminal
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 83
AfiI CCNNNNNNNGG 2 cut(s) 149, 180
AgsI TTSAA 2 cut(s) 71, 202
AluBI AGCT 1 cut(s) 117
AluI AGCT 1 cut(s) 117
AlwI GGATC 1 cut(s) 83
ApeKI GCWGC 1 cut(s) 208
AsuHPI GGTGA 1 cut(s) 163
BbvI GCAGC 1 cut(s) 195
BccI CCATC 1 cut(s) 56
BisI GCNGC 1 cut(s) 209
BlsI GCNGC 1 cut(s) 210
BpuEI CTTGAG 2 cut(s) 121, 201
Bsc4I CCNNNNNNNGG 2 cut(s) 149, 180
BseLI CCNNNNNNNGG 2 cut(s) 149, 180
BseXI GCAGC 1 cut(s) 195
BslI CCNNNNNNNGG 2 cut(s) 149, 180
Bsp143I GATC 2 cut(s) 12, 88
BspPI GGATC 1 cut(s) 83
BssMI GATC 2 cut(s) 12, 88
Bst4CI ACNGT 2 cut(s) 76, 134
Bst6I CTCTTC 1 cut(s) 75
BstKTI GATC 2 cut(s) 15, 91
BstMBI GATC 2 cut(s) 12, 88
BstV1I GCAGC 1 cut(s) 195
BtsIMutI CAGTG 1 cut(s) 139
CviJI RGCY 2 cut(s) 66, 117
CviKI_1 RGCY 2 cut(s) 66, 117
DpnI GATC 2 cut(s) 14, 90
DpnII GATC 2 cut(s) 12, 88
Eam1104I CTCTTC 1 cut(s) 75
EarI CTCTTC 1 cut(s) 75
FaiI YATR 3 cut(s) 150, 156, 177
Fnu4HI GCNGC 1 cut(s) 209
Fsp4HI GCNGC 1 cut(s) 209
GluI GCNGC 1 cut(s) 209
HincII GTYRAC 1 cut(s) 130
HindII GTYRAC 1 cut(s) 130
HphI GGTGA 1 cut(s) 163
Hpy166II GTNNAC 1 cut(s) 130
Hpy188III TCNNGA 2 cut(s) 100, 231
Hpy8I GTNNAC 1 cut(s) 130
HpyCH4III ACNGT 2 cut(s) 76, 134
HpyCH4V TGCA 1 cut(s) 27
Kzo9I GATC 2 cut(s) 12, 88
LmnI GCTCC 1 cut(s) 183
LpnPI CCDG 1 cut(s) 96
Lsp1109I GCAGC 1 cut(s) 195
MalI GATC 2 cut(s) 14, 90
MboI GATC 2 cut(s) 12, 88
MboII GAAGA 1 cut(s) 92
MfeI CAATTG 1 cut(s) 38
MluCI AATT 4 cut(s) 5, 38, 160, 187
MseI TTAA 2 cut(s) 8, 48
MunI CAATTG 1 cut(s) 38
NdeII GATC 2 cut(s) 12, 88
PkrI GCNGC 1 cut(s) 210
SaqAI TTAA 2 cut(s) 8, 48
SatI GCNGC 1 cut(s) 209
Sau3AI GATC 2 cut(s) 12, 88
SetI ASST 3 cut(s) 119, 145, 176
SgeI CNNG 6 cut(s) 112, 123, 130, 137, 192, 230
SmlI CTYRAG 2 cut(s) 100, 216
SmoI CTYRAG 2 cut(s) 100, 216
Sse9I AATT 4 cut(s) 5, 38, 160, 187
TaaI ACNGT 2 cut(s) 76, 134
TasI AATT 4 cut(s) 5, 38, 160, 187
Tru1I TTAA 2 cut(s) 8, 48
Tru9I TTAA 2 cut(s) 8, 48
TscAI CASTG 1 cut(s) 139
TseI GCWGC 1 cut(s) 208
TspRI CASTG 1 cut(s) 139
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.