Rh6BG392000

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6B
OG0001875
Physical Location & Seq
Reverse (-)
62044996 .. 62045481
486 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6BG392000.1

Sequence Viewer

Length: 372 bp
ATGGCAGCTATAATGAAATTTCTCTTCATTGCCATCCTTTGCAGCCTCATTATGGGAGGCGATTGTCAACCTTGCTCTGAGAAGAATTTGATTATTATACAGTCAGCAACGGGAAAGTTGGTTCAAAATAAGCCAGAATGGAATGTAAAGATCACTAACAACTGCATTTGTTCTCAATTGAGTGTTAAGCTGAGTTGTGATGGCTTTCAAACTGTGGAAGAGATTGATCCTACAATCTTGAGCAAATCTGGTAGCTTGTGTCTTGTCAACAGTGGCGAACCTATCTATGGGCATAGCAATTTCAGTTTCACCTATGCGTGGAGCAATTCGTTTCCTTTCAAAACGCTGTTCTCTCAAGCTGCTTGTTCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

123

Amino Acids

13.43

Weight (kDa)

6.52

Isoelectric Point (pI)

37.24

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
TPD1_C PF24068 27 - 122 8.6e-31 Tapetum determinant 1, C-terminal
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 221
AcsI RAATTY 2 cut(s) 17, 85
AfiI CCNNNNNNNGG 3 cut(s) 52, 287, 318
AgsI TTSAA 3 cut(s) 125, 209, 340
AloI GAACNNNNNNTCC 2 cut(s) 105, 137
AluBI AGCT 4 cut(s) 8, 190, 255, 359
AluI AGCT 4 cut(s) 8, 190, 255, 359
AlwI GGATC 1 cut(s) 221
ApeKI GCWGC 3 cut(s) 5, 42, 359
ApoI RAATTY 2 cut(s) 17, 85
AsuHPI GGTGA 1 cut(s) 301
BbvI GCAGC 3 cut(s) 17, 54, 346
BccI CCATC 2 cut(s) 41, 194
BisI GCNGC 3 cut(s) 6, 43, 360
BlsI GCNGC 3 cut(s) 7, 44, 361
BpuEI CTTGAG 2 cut(s) 259, 339
Bsc4I CCNNNNNNNGG 3 cut(s) 52, 287, 318
Bse3DI GCAATG 1 cut(s) 27
BseGI GGATG 1 cut(s) 33
BseLI CCNNNNNNNGG 3 cut(s) 52, 287, 318
BseMI GCAATG 1 cut(s) 27
BseMII CTCAG 2 cut(s) 69, 182
BseXI GCAGC 3 cut(s) 17, 54, 346
BslI CCNNNNNNNGG 3 cut(s) 52, 287, 318
Bsp143I GATC 2 cut(s) 150, 226
BspCNI CTCAG 2 cut(s) 70, 183
BspPI GGATC 1 cut(s) 221
BsrDI GCAATG 1 cut(s) 27
BssMI GATC 2 cut(s) 150, 226
Bst4CI ACNGT 3 cut(s) 102, 214, 272
Bst6I CTCTTC 2 cut(s) 29, 213
BstDEI CTNAG 2 cut(s) 78, 191
BstF5I GGATG 1 cut(s) 33
BstKTI GATC 2 cut(s) 153, 229
BstMBI GATC 2 cut(s) 150, 226
BstV1I GCAGC 3 cut(s) 17, 54, 346
BtsCI GGATG 1 cut(s) 33
BtsIMutI CAGTG 1 cut(s) 277
CviJI RGCY 7 cut(s) 8, 45, 133, 190, 204, 255, 359
CviKI_1 RGCY 7 cut(s) 8, 45, 133, 190, 204, 255, 359
DdeI CTNAG 2 cut(s) 78, 191
DpnI GATC 2 cut(s) 152, 228
DpnII GATC 2 cut(s) 150, 226
Eam1104I CTCTTC 2 cut(s) 29, 213
EarI CTCTTC 2 cut(s) 29, 213
FaiI YATR 6 cut(s) 11, 53, 98, 288, 294, 315
Fnu4HI GCNGC 3 cut(s) 6, 43, 360
FokI GGATG 1 cut(s) 20
Fsp4HI GCNGC 3 cut(s) 6, 43, 360
GluI GCNGC 3 cut(s) 6, 43, 360
HincII GTYRAC 2 cut(s) 68, 268
HindII GTYRAC 2 cut(s) 68, 268
HphI GGTGA 1 cut(s) 301
Hpy166II GTNNAC 2 cut(s) 68, 268
Hpy188I TCNGA 1 cut(s) 79
Hpy188III TCNNGA 2 cut(s) 238, 369
Hpy8I GTNNAC 2 cut(s) 68, 268
HpyCH4III ACNGT 3 cut(s) 102, 214, 272
HpyCH4V TGCA 2 cut(s) 42, 165
HpyF3I CTNAG 2 cut(s) 78, 191
Kzo9I GATC 2 cut(s) 150, 226
LmnI GCTCC 1 cut(s) 321
LpnPI CCDG 2 cut(s) 147, 234
Lsp1109I GCAGC 3 cut(s) 17, 54, 346
MalI GATC 2 cut(s) 152, 228
MboI GATC 2 cut(s) 150, 226
MboII GAAGA 3 cut(s) 16, 94, 230
MfeI CAATTG 1 cut(s) 176
MluCI AATT 5 cut(s) 17, 85, 176, 298, 325
MnlI CCTC 2 cut(s) 50, 56
MseI TTAA 1 cut(s) 186
MunI CAATTG 1 cut(s) 176
NdeII GATC 2 cut(s) 150, 226
PkrI GCNGC 3 cut(s) 7, 44, 361
SaqAI TTAA 1 cut(s) 186
SatI GCNGC 3 cut(s) 6, 43, 360
Sau3AI GATC 2 cut(s) 150, 226
SetI ASST 7 cut(s) 10, 73, 192, 257, 283, 314, 361
SgeI CNNG 9 cut(s) 84, 123, 146, 250, 261, 268, 275, 330, 368
SmlI CTYRAG 2 cut(s) 238, 354
SmoI CTYRAG 2 cut(s) 238, 354
Sse9I AATT 5 cut(s) 17, 85, 176, 298, 325
TaaI ACNGT 3 cut(s) 102, 214, 272
TasI AATT 5 cut(s) 17, 85, 176, 298, 325
Tru1I TTAA 1 cut(s) 186
Tru9I TTAA 1 cut(s) 186
TscAI CASTG 1 cut(s) 277
TseI GCWGC 3 cut(s) 5, 42, 359
TspDTI ATGAA 2 cut(s) 16, 29
TspRI CASTG 1 cut(s) 277
XapI RAATTY 2 cut(s) 17, 85
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.